January 3, 2013
Secondary Stress: Proteomics
Analysis of QE data
downloaded mzXML files for QE data onto Mac mini PC from the server where Jimmy uploaded them. The xml files were previously downloaded.

Enrichment analysis of differentially expressed proteins in QE data for ambient vs. high pCO2 only (MS samples included but not acknowledged as different treatment). Made a list of all of the unique SPIDs that correspond to the proteins that had at least 10 spectral hits across replicates - this is the background for DAVID. Made 4 gene lists for analysis: 1) SPIDs corresponding to proteins that were differentially expressed according to a t-test, 2) SPIDs of proteins that were at least 2-fold up-regulated, 3) proteins at least 2-fold down-regulated, 4) all 3 previous categories combined.
For category 1 (t-test), enriched GO terms were protein folding, peripheral nervous system development, mitotic cell cycle, macromolecular complex assembly, cell cycle process, macromolecular complex subunit organization, protein complex biogenesis.
For category 2 (up-reg at least 2 fold): protein heterooligomerization, regulation of transcription, regulation of transcription DNA-dependent, transcription, protein complex biogenesis, protein complex assembly, macromolecular complex subunit organization, regulation of RNA metabolic process, macromolecular complex assembly, pyrimidine nucleotide biosynthetic process, pyrimidine nucleotide metabolic process, regulation of transcription from RNA polymerase II promoter, positive regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process.
For category 3 (down-reg at least 2 fold): muscle organ development, cellular protein localization, muscle tissue development, skeletal muscle organ development, cellular macromolecular localization, intracellular protein transport, induction of apoptosis, protein import, regulation of transcription DNA-dependent.
For category 4: mitotic cell cycle checkpoint, protein complex assembly, protein complex biogenesis, regulation of transcription DNA-dependent, cell cycle checkpoint, macromolecular complex assembly, macromolecular complex subunit organization, pyrimidine nucleotide metabolic process, pyrimidine nucleotide biosynthetic process, membrane organization, response to abiotic stimulus, protein import, protein oligomerization, detection of stimulus, enzyme linked receptor protein signaling pathway, positive regulation of nitrogen compound metabolic process, positive regulation of transcription from RNA polymerase II promoter, sulfur amino acid metabolic process.

January 2, 2013
Secondary Stress: Proteomics
Analysis of QE data
From stats done 12/20/12, made list of unique protein IDs of differentially expressed proteins (for each treatment comparison the protein is either differentially expressed according to the t-test with p<0.05, or according to fold change of at least 2 up- or down-regulated). This is 1,086 proteins. Made a fasta file of the protein sequences (from genome v9) corresponding to these CGI IDs in Geneious.

Did DESeq on protein expression data from QExactive. Created 2 input files: one to compare effects of pCO2 (on non-mechanically stressed oysters only) and one to compare the effects of MS on the ambient pCO2 oysters. Both were treated as single-end libraries. The comparison of the pCO2 treated oysters yielded one protein that was differentially expressed with an adjusted p-value of < 0.1: CGI_10005508 (this protein is already included in the differentially expressed list described above). There was no protein expression different due to mechanical stress in the ambient pCO2 oysters according to DESeq.
protein CGI_10005508 is putatively carboxymethylenebutenolidase

December 21, 2012
Secondary Stress: Proteomics
Continuation of analysis of QE data
Joined file of proteins with at least 10 spec counts across replicates to GO and GO Slim terms in Galaxy. In Excel, separated the file into 3 parts based on GO terms: cellular components, molecular function, and biological processes. For today, will just do analysis at the biological processes level. For each of the 3 sub-files, filtered to maintain unique protein-GO term combinations. Kept only proteins that were annotated with SPIDs with an evalue of less than or equal to 1E-5. Did the same process for GO Slim terms.
To create file of spec counts per GO term, sorted spec counts, protein ID, and GO term by GO term. Removed redundant entries so that a protein is not counted multiple times for one GO term. For each GO term, summed the spec counts for each oyster and then pasted into a new spreadsheet. The new spreadsheet has GO terms in the first column followed by the sum of all spec counts for that term for each oyster. Did the same for GO Slim biological processes.
Did NMDS (described 12/20/12) on oysters described by GO or GO Slim terms and ANOSIM looking at effect of pCO2, MS, and combination of MS + pCO2. There was no difference in expression among treatments at the GO or GO Slim levels.

NMDS using GO terms:
http://eagle.fish.washington.edu/oyster/NMDS%20GO%20processes%20loadings%20122112.jpg
http://eagle.fish.washington.edu/oyster/NMDS%20GO%20processes%20polygons%20122112.jpg



NMDS using GO Slim:
http://eagle.fish.washington.edu/oyster/NMDS%20GO%20slim%20processes%20loadings%20122112.jpg
http://eagle.fish.washington.edu/oyster/NMDS%20GO%20slim%20processes%20polygons%20122112.jpg



December 20, 2012
Secondary Stress: Proteomics
Analysis of proteomic data from the QExactive
In Galaxy, viewed joined file and selected "view all". Copied and pasted into text wrangler. Under Search > Find searched for "QE" and replaced with "\r" enabling grep. This makes a line break at every QE. Saved and opened in excel to edit (some columns need re-aligning).
Removed proteins that had fewer than 10 spectral counts across all replicates (remaining proteins = 2,437). Summed spectral counts across technical reps, within biological reps.
Annotated the proteins joined to the summed spec counts in Galaxy.
Statistics in Excel to get an idea of potential important proteins in differential expression. For the following treatment comparisons, calculated p-value (type 2, 2-tailed t-test) and fold change (stressor/control): mechanical stress in High pCO2, MS in ambient pCO2, MS, pCO2.
t-test results: 135 proteins were differentially expressed due to MS at high pCO2, 97 were differentially expressed due to MS at ambient pCO2, 119 were differentially expressed due to MS across pCO2 treatments, 145 were differentially expressed due to pCO2 (this included oysters that had been exposed to MS).
fold change results (down regulated at least 2 fold): 267 due to MS at high pCO2, 322 due to MS at ambient pCO2, 177 due to MS across pCO2, 206 due to high pCO2.
fold change results (up regulated at least 2 fold): 236 due to MS at high pCO2, 164 due to MS at ambient pCO2, 155 due to MS across pCO2, 129 due to high pCO2.

Made 4 datasets from proteomic data for NMDS and ANOSIM: 1 dataset had all the proteins included, the second dropped low abundance proteins (expressed in < 1/2 oysters), the third dropped high abundance proteins (occurred in >95% of the oysters), and the fourth dropped both low and high abundance. Did NMDS using a Bray-Curtis dissimilarity matrix and ANOSIM. There was no significant difference among treatments at the protein level. Below are NMDS for the dataset with all proteins (including low and high abundance). The loadings (blue arrows) are all proteins that contribute significantly to the distribution of objects (oysters) with a significance of p=0.01 or lower.



Tomorrow: NMDS and ANOSIM at GO and GO Slim level.

December 19, 2012
Secondary Stress: Proteomics
Joined all QExactive replicates to the QE sequenced proteome in Galaxy (replicates are joined in alpha numeric order, starting with 101B_2_01 and ending with 103B_251_03). Galaxy will not let me download the file right now so I'll try again tomorrow :(

December 18, 2012
Secondary Stress: Proteomics
Prepared QExactive protein prophet files for upload and joining in Galaxy.
Created a non-redundant list of all the proteins (with Protein prophet probability cutoff of 0.9) that were sequenced on the QExactive ("QE sequenced proteome"). There are 4265 proteins in the list.


December 14, 2012
Secondary Stress: RNA-Seq
Ran DAVID analysis today for files prepared 12/13/12. For genes that were differentially expressed according to a t-test, there was an enrichment of GO terms for protein amino acid phosphorylation, sensory perception of light stimulus, visual perception, heparan sulfate proteoglycan biosynthetic process, heparan sulfate proteoglycan metabolic process, protein catabolic process. There were 60 GO terms enriched in the genes that were at least 2-fold more highly expressed at high pCO2. 40 GO categories were enriched in the genes up-regulated at ambient pCO2. For the group of genes differentially regulated (combination of the previous 2 groups), 63 GO categories were enriched. Below are pie charts of the GO Slim terms representing number of enriched GO terms for each category.
GO Slim categories corresponding to contigs differentially expressed according to t-test: http://eagle.fish.washington.edu/oyster/t.test%20sig%20diff%20GO%20Slim%20121412.jpg

GO Slim categories of contigs up-regulated at ambient pCO2 (at least 2-fold): http://eagle.fish.washington.edu/oyster/ambient%20pCO2%20upreg%20GO%20slim%20121412.jpg

GO Slim categories of contigs up-regulated at high pCO2 (at least 2-fold): http://eagle.fish.washington.edu/oyster/high%20pCO2%20upreg%20GO%20Slim%20121412.jpg

GO Slim categories of contigs differentially regulated at least 2-fold: http://eagle.fish.washington.edu/oyster/diff%20reg%20GO%20Slim%20121412.jpg

NMDS and ANOSIM at contig, GO, and GO slim levels excluding oyster D. No better resolution was achieved, ANOSIM for GO and GO Slim levels was insignificant.
NMDS of contigs without oyster D: http://eagle.fish.washington.edu/oyster/NMDS%20contigs%20no%20oyster%20D%20121412.jpg




NMDS of GO terms without oyster D: http://eagle.fish.washington.edu/oyster/NMDS%20GO%20no%20oyster%20D%20121412.jpg


NMDS of GO slim without oyster D: http://eagle.fish.washington.edu/oyster/NMDS%20GO%20slim%20no%20oyster%20D%20121412.jpg


performed hierarchical clustering in CLC on expression experiment 121312. Used Euclidean distance, average linkage, original expression values. Also did statistical analysis on Gaussian data: T-test variances homogeneous (variances assumed to be equal), comparisons = all pairs, use original expression values, add corrected p-values for bonferroni and FDR.
volcano plot: http://eagle.fish.washington.edu/oyster/volcano%20plot%20121412.jpg



December 13, 2012
Secondary Stress: RNA-Seq
On 12/3/12 I did a de novo assembly of the 8 tag-seq libraries to make consensus isotigs. Also on 12/3 I did RNA-Seq of the libraries against this de novo assembly to get expression values for each isotig (the contig numbers are conserved across the de novo assembly and the RNA-Seq). On 12/4, all the RNA-Seq files were joined together to form the file "all isotig RNA-Seq joined". On 12/5, blasted the isotigs against Sigenae v8 for annotation.
Edited the file from 12/5 so that instead of isotig names reading "Consensus from Contig 116" they read "Contig116". This file gives the number of reads mapped to each isotig by sample library (8 libraries). The only isotigs used in further analysis are those with at least 10 reads mapped across the 8 libraries. Saved tab-delim text file as "library reads mapped to isotigs".
In Galaxy, joined isotig reads mapped file with isotig blastn sigenae v8 results. Then joined with Cg Sigenae8 best hit to get SPID annotations. Then joined with Cg Sigenae ontology to annotate with GO terms. Also joined with Go Slim terms. File is called "isotig reads mapped annotated".
To get number of reads per isotig, made 8 separate pivot tables (1 for each library) of the sum of number of mapped reads per Sigenae accession number. For each library, a large number of reads map to isotigs that do not have a blastn result against the Sigenae database.
Made input file for DESeq of total reads mapped per contig in each library (file = Sigenae reads DESeq).
DESeq plots:
variance estimation: http://eagle.fish.washington.edu/oyster/variance%20estimation%20sigenae%20121312.pdf

differential expression: http://eagle.fish.washington.edu/oyster/diff%20exp%20sigenae%20121312.pdf

pvalues: http://eagle.fish.washington.edu/oyster/pvalues%20sigenae%20121312.pdf

6 genes are differentially expressed (adjusted p-value < 0.05), all are up-regulated in the high pCO2:
CU682172 = hyaluronan-mediated motility receptor
FV2TRRU02GXXJN = heat shock 70 kDa protein
AM857082 = TPR and ankyrin repeat-containing protein
CU999485 = DNA binding protein SMUBP
CU996918 = D. rerio hypothetical protein
FU6OSJA01A8KLU = not annotated

Exploration of differentially expressed genes as determined by t-test. Did a t-test (type 2, 2-tailed) in Excel for each Sigenae contig based on sum of all reads. Annotated the contigs with SPIDs. Also divided the sum of the reads for the high pCO2 libraries by the sum of the reads for the ambient pCO2 library for each Sigenae contig. Now there are 2 new metrics for looking for differentially expressed genes: significance from the t-test (p<0.05) and fold change. To look for enrichment of GO categories in these groups of genes, made a DAVID input file with genes that are sig diff according to the t-test, highly expressed (2-fold or greater) in high pCO2, highly expressed in ambient pCO2. Removed redundancy from spid lists. The background for DAVID is the SPIDs annotating all of the Sigenae contigs (all SPID annotations have an evalue of less than 1E-5).
DAVID is currently down so may need to run these analyses tomorrow.
Some of the genes that are differentially expressed according to the t-test (335 total) are hsc70, hsp70, cytochrome p450, v-type proton ATPase, ficolin.
A total of 2121 genes were expressed less at high pCO2 compared to low pCO2 (by at least 2-fold). These included cathepsin, hsp70, ficolin, v-type proton ATPase, caspase-14, metallothionein, cytochrome p450, hsc70, defensin.
885 genes were expressed at least 2-fold more highly in the high pCO2 treatment, including multidrug resistance-associated protein, hsp70, glutathione peroxidase, v-type proton ATPase, peroxiredoxin 6.

RNA-Seq experiment on CLC. Set up experiment with the RNA-Seq files from 12/3/12 (reads mapped back to de novo assembly of isotigs). Parameters: two-group comparison unpaired, use existing expression values from samples. Assigned libraries to groups "high pCO2" and "ambient". Saved in folder "expression experiment 121312".

Multivariate analysis of RNA-Seq data, starting with contig level. Input file is sum of reads across isotigs for each contig. Did parallel analyses for the entire data set (10341 contigs) and for the dataset without low abundance genes (expressed in fewer than 8 oysters, 4228 contigs). Did log(x+1) transformation and used bray-curtis dissimilarity coefficient. Did hierarchical agglomerative clustering and made average linkage dendrograms. There was no clear pattern according to treatment.
all contigs: http://eagle.fish.washington.edu/oyster/average-linkage%20dend,%20all%20isotigs%20121312.pdf

without low abundance contigs: http://eagle.fish.washington.edu/oyster/avg-linkage%20dend,%20no%20low%20abundance%20isotigs%20121312.pdf

Also did clustering with euclidean distance instead of bray-curtis and dendrograms looked identical using the different coefficient.

Next did NMDS. NMDS plots do not show vector loadings because there were too many arrows.
NMDS all contigs: http://eagle.fish.washington.edu/oyster/NMDS%20all%20isotigs%20121312.pdf

NMDS no low abundance: http://eagle.fish.washington.edu/oyster/NMDS%20no%20low%20abundance%20isotigs%20121312.pdf

There was no significant effect of treatment on gene expression for either dataset using ANOSIM.

Multivariate analysis at GO and GO Slim levels (instead of individual contig). Annotated contigs in Galaxy with GO and GO Slim terms. For now I will only work with the biological processes terms. Made worksheets of contigs, read counts for each library, and GO or GO slim terms (removed redundancies). Made pivot tables for each library: sum of reads within GO or GO slim category.
NMDS at go and go slim level still shows lack of resolution between treatment groups. This may be because oyster D is an outlier. Will try same analysis but without oyster D.

December 12, 2012
Secondary Stress: Proteomics
Continuation of Skyline analysis.
Brendan (developer of Skyline) responded to my query regarding how to treat the different precursor charges:
It really depends on what you are doing. If you measured both charge states and the data is good, then you would probably get a more accurate measurement of peptide abundance by summing the TotalArea values of both, under the principle that more ions measured will increase your precision.

If one charge state is a very small fraction of another, and has a totally different lower limit of quantification (LOQ), then, yes, you will probably want only the better precursor, since including the worse performing precursor is likely just decrease your linear range of detection, if you sum the two, and using them separately will just give you two different measures for the same thing, with one being provably worse than the other

It seems that the precursor charge 2 is less than half of the 3 charge state. Peptides that have only one charge state are a 2. Based on this, I'm just going to keep the data for the 2 charge state and discard the 3 state for further analyses.
For high pCO2 and high pCO2 + MS, created input files for Galaxy of the Prot-Pep combined indicator and the average peak area for that peptide. Made a backbone to join these files to of the prot-pep names for each treatment. Annotated proteins with SPIDs.
Created column in spreadsheet (MS vs NS) of the avg total peak area for the high pCO2 MS samples divided by the avg total peak area for high pCO2 (NS) samples. Some of the peptides that were up-regulated in the mechanically stressed oysters are beta-hexosaminidase (MS/NS = 206.031453), calmodulin (MS/NS = 103), clathrin (MS/NS = 18), putative universal stress protein (MS/NS = 8), myosin (MS/NS = 6), dual oxidase (MS/NS = 3), Some of the peptides that were down-regulated in the MS oysters included dual oxidase (MS/NS = 0.006), MAPK (MS/NS = 0.17), HSP70 (MS/NS = 0.2), stress-induced phosphoprotein (MS/NS = 0.38), v-type proton ATPase (MS/NS = 0.4), cathepsin L (MS/NS = 0.44). Next step for these proteins is to do an enrichment analysis for the up- and down-regulated proteins in mechanical stress. Differential regulation = at least 2-fold difference in expression. Overall, 162 peptides were down-regulated with mechanical stress at high pCO2 and 48 were up-regulated.

Repeated the same steps in Skyline to compare expression profiles between the high and ambient pCO2 oysters (no MS) and the ambient MS oysters vs. controls.
In ambient versus high pCO2, 71 proteins were upregulated at high pCO2, including dual oxidase (high/ambient = 212), MAPK (high/amb = 5), clathrin (high/amb = 3.7), HSP70 (high/amb = 2.8), v-type proton ATPase (high/amb = 2.5). 74 proteins were down-regulated, including glucose-6-phosphate isomerase (high/amb = 0.16), long chain fatty acid ligase (high /amb = 0.41).
In the comparison between ambient pCO2 no additional stress (NS) and mechanical stress (MS), 52 peptides were up-regulated in the MS and 246 were down-regulated.

Used all SPID annotations matching to proteins used in the analysis for the DAVID background. Generated lists of SPIDs corresponding to peptides down- and up-regulated at high pCO2 compared to ambient, ambient + MS compared to ambient, and high pCO2 + MS compared to high pCO2. All of the lists were filtered for redundancy. Enriched Gene Ontology categories are listed below for each treatment group (GOTERM_BP_FAT).
upregulated in Ambient MS: carbohydrate catabolic process, alcohol catabolic process
downregulated in High pCO2: cell adhesion, biological adhesion, blood vessel morphogenesis, vasculature development, blood vessel development
upregulated in High pCO2 MS: cognition, ion homeostasis, regulation of membrane potential, cellular ion homeostasis, cellular chemical homeostasis, chemical homeostasis, neurological system process, behavior

December 11, 2012
Secondary Stress: Proteomics
NMDS and ANOSIM of proteomics GO terms for molecular function. 170 unique GO terms were used in the analysis. There was no difference among treatments based on ANOSIM.
NMDS with GO molecular function loadings: https://www.evernote.com/shard/s242/sh/82b3879f-f671-44a5-9b31-1fceee9b4a56/0420e49a47260565269e13343a7a4b81




http://eagle.fish.washington.edu/oyster/GO%20function%20NMDS%20with%20loadings.pdf

NMDS with GO molecular function polygons:
https://www.evernote.com/shard/s242/sh/215f7268-5a83-48f5-91ce-62e765ce76ec/58b3abc34a9df224d24d68cebf2c0ca1
http://eagle.fish.washington.edu/oyster/GO%20function%20NMDS%20with%20polygons.pdf


Repeated the same process except using GO Slim categories instead of GO. Divided up the cellular component, molecular function, and biological processes GO Slim terms. Removed proteins that were annotated with an evalue >1E-5. Removed redundant protein-GO Slim combinations. For now, I am only going to do the NMDS and ANOSIM for the biological processes GO Slim terms. Created an input file for R (as described 12/10/12). The ANOSIM analysis was significant for the effect of pCO2 on protein expression and the combined effects of pCO2 and MS, but not for MS alone.
NMDS GO Slim biological processes with loadings (p=0.01): https://www.evernote.com/shard/s242/sh/c32fd0f4-b716-4256-86f5-b48da431f038/cadfaa41f2874a1b924993636f1bd546
http://eagle.fish.washington.edu/oyster/GO%20Slim%20processes%20NMDS%20with%20loadings.pdf

NMDS GO Slim biological processes with polygons: https://www.evernote.com/shard/s242/sh/a1faca45-9cb3-482b-bd9c-b007e50af15f/60d0a00efae2198edc34a543b7004455
http://eagle.fish.washington.edu/oyster/GO%20Slim%20processes%20NMDS%20with%20polygons.pdf

ANOSIM pCO2: https://www.evernote.com/shard/s242/sh/c800d8a4-76fb-4087-abd0-1dc4f99fb6e8/4373a8246c850818594c338d5a13a831
http://eagle.fish.washington.edu/oyster/GO%20Slim%20processes%20ANOSIM%20pCO2.pdf

ANOSIM pCO2 and MS: https://www.evernote.com/shard/s242/sh/3eb00b58-3d9f-44a5-aec1-5e5a257c6eb7/10028d4fcc08a96a146d696915a752a4
http://eagle.fish.washington.edu/oyster/GO%20Slim%20processes%20ANOSIM%20pCO2%20and%20MS.pdf


Enrichment analysis of proteomics data. Proteins used have at least 10 spectral counts across all replicates. The common list of proteins that fit this criterion are used as the backbone in DAVID. Made input file with one column of CGI protein accession numbers for each treatment group. Within each group, a protein is included in the input file if it has at least 4 spectral counts across the 4 oysters. The CGI accession numbers were joined with the blastx output (SPIDs) in Galaxy to make files for DAVID. Only unique SPIDs within treatment groups were kept in the final file for DAVID (v. 6.7).
The only GO term that was enriched (GOTERM_BP_FAT) was for high pCO2 + MS (regulation of transcription).

Analysis of proteins of interest in Skyline.
Downloaded zipped files (from Jimmy, mzXML_OT1, pepxml_OT1, pepxml_QE) from proteomics server onto "Mac" mini. These files extract to the files needed to build libraries in Skyline.
Also put protein of interest fasta file (see 12/6/12) onto Eagle to download and use in Skyline.
Settings > Peptide settings> Enzyme: Trypsin [KR|P]
max missed cleavages = 2
background proteome = none
Peptide settings > modifications > edit structural modifications: choose oxidation (M) from the drop-down list, check variable box.
Peptide settings > library > build: name = oyster proteins, keep redundant library, cut-off score = 0.95, lab authority = roberts.fish.washington.edu. Selected all "v9" interact files (these are the files that were searched against the genome and have been filtered for more probable proteins). pick peptides matching library.
Settings > transition settings > Filter: precursor charges = 2,3,4; ion charges = 1,2,3; ion types =p; auto-select all matching transitions.
transition settings > library: uncheck if a library spectrum is available, pick its most intense ions
transition settings > full-scan: isotope peaks included = count; precursor mass analyzer = orbitrap; peaks = 3, resolving power = 60,000 at 400, use only scans within 5 minutes of MS/MS IDs.
File > import > FASTA to import proteins of interest determined by prior analysis (C. gigas proteins for Skyline.fasta).
Settings: Integrate all
View > peak areas: replicate comparison
View > peak areas: right click and normalize to > none
All raw data files were imported as single injections.
Created export format for report titled "Oyster report". All 4 treatments are exported as separate csv files (in folder Skyline output 121012). In Excel, created worksheet of protein name, peptide sequence, sample name, total area, and cvtotalarea. Removed redundant entries. Created new column next to total area called prot-pep and concatenated the protein name and peptide sequence. Then selected the prot-pep and totalarea columns and made a pivot table with the prot-pep name as the row labels and the total area as the sum values (make sure to select sum!). This gives a table with the total sum of the peptide peak areas for each peptide (i.e. expression). Made another pivot table except with the average of the total area for each peptide.
There were redundancies in the original output file (some of the peptides had multiple peak areas for a sample), so re-exported the file with the columns: precursors charge, precursors isotope label type, precursors modified sequence. New file is called Skyline high pCO2 additions.csv. Also exported results for high pCO2 with mechanical stress.
The redundancy is caused by different precursor charges (2 vs 3). I'm not sure how to deal with this yet...

December 10, 2012
Secondary Stress: Proteomics
Did ANOSIM on protein expression visualized in NMDS 12/7/12. Created csv file with 3 columns describing the 16 oysters (oyster names in first column). One column had just the pCO2 treatment designators, one column had just MS, and one had the combination of the 2 stresses. ANOSIM was performed 3 separate times using the 3 columns as grouping variables for protein expression. For each analysis p>0.05, so protein expression did not explain differences between groups in a statistically significant way.

Repeat of NMDS and ANOSIM on protein expression data except proteins will be grouped functionally (by GO and GO Slim terms) and spec counts will be summed within functional groups. 2 files were made in Galaxy: one with proteins annotated to GO and one with annotations to GO Slim.

Divided up the analyses for GO and GO Slim based on GO type (component, function, process). Only kept annotations that had an e-value for the blastx of less than or equal to 1E-5. Removed redundant protein-GO combinations. The input file for R is structured with oyster number (n=16) as row names, GO terms as column headers, and individual cells containing the total spec counts for each oyster in that GO category. There were 219 unique GO terms for biological processes that contributed to the NMDS.
NMDS with GO term loadings: https://www.evernote.com/shard/s242/sh/50166277-b274-4ae5-a89b-00ec1803fed0/5359bc7c29c75f6446ae9c5d94256d26
http://eagle.fish.washington.edu/oyster/GO%20NMDS%20with%20loadings.pdf

NMDS (GO) with polygons depicting treatment groups: https://www.evernote.com/shard/s242/sh/151d9a4b-59bc-4876-b071-e16838d23710/159fcaedd890a23decbc80f761be316c
http://eagle.fish.washington.edu/oyster/GO%20NMDS%20with%20polygons.pdf


ANOSIM indicated that the effect of pCO2 was significant on the differences among groups (p=0.029), there was no significant effect of just mechanical stress (MS), but there was a significant difference among groups when both stressors were considered (p=0.05).
ANOSIM of pCO2 effect only: https://www.evernote.com/shard/s242/sh/d7708eef-cdde-4b06-9f71-2e077dc7c808/135b60942113a8565a32d5eb53c92b99
http://eagle.fish.washington.edu/oyster/GO%20ANOSIM%20pCO2%20only.pdf


ANOSIM of pCO2 + MS: https://www.evernote.com/shard/s242/sh/75e585e6-5de2-4467-b701-63bfbd295506/45931721da1dfa657f5b7eea5614102f
http://eagle.fish.washington.edu/oyster/GO%20ANOSIM%20pCO2%20and%20MS.pdf


There are 98 individual GO terms corresponding to cellular components used in the multivariate analysis. After ANOSIM, there is no significant difference in protein express (for cellular components) among treatment groups.
NMDS with GO term loadings: https://www.evernote.com/shard/s242/sh/15800bfb-bd93-434d-815d-4b04ffb04f7b/f96eba07f7a7b54e18b803b4d711f94f
http://eagle.fish.washington.edu/oyster/GO%20components%20NMDS%20with%20loadings.pdf

NMDS with polygons: https://www.evernote.com/shard/s242/sh/8eaffd1c-f368-4d9d-985b-29f9e39f6736/9b62e0d175f214144db4135a4111541a
http://eagle.fish.washington.edu/oyster/GO%20components%20NMDS%20with%20polygons.pdf


December 7, 2012
Secondary Stress: Proteomics
Multivariate statistics for proteomics (based on a conversation with Julian Olden).
First round of analyses is on proteomics at the individual protein level. The input file is total spectral counts (across 3 technical replicates) for each biological replicate. I did the exact same NMDS for 4 different versions of the dataset: all proteins included, removed proteins that were low abundance (only expressed in 8 or fewer oyster, n=35 proteins), removed proteins that were high abundance (expressed in at least 95% of the oysters, n=779 proteins), removed both low and high abundance proteins. Each dataset was log-transformed and the Bray-Curtis dissimilarity coefficient was used. Only 2 dimensions were needed to explain the data. Links to the NMDS plots are below. The numbers represent individual oysters. 2-11 = high pCO2, 26-35 = high pCO2+mechanical stres, 221-230=ambient pCO2, 242-251 = ambient pCO2 + mechanical stress.
NMDS of dataset with low and high abundance proteins removed: https://www.evernote.com/shard/s242/sh/09f65203-1bde-4424-84a6-635083432b56/89538a8722f62427372be61c9cceccff
http://eagle.fish.washington.edu/oyster/NMDS%20no%20low%20high%20abundance%20120712.pdf

low abundance removed: https://www.evernote.com/shard/s242/sh/cae42bdb-14a9-4e1a-8fa4-e1475a8f1fad/bd876271d6ad157e9380ef200f9f9606
http://eagle.fish.washington.edu/oyster/NMDS%20no%20low%20abundance%20120712.pdf


high abundance removed: https://www.evernote.com/shard/s242/sh/b32c814b-4041-47d9-a7ee-d26622fd26dd/0ac4a5868af643dedcf73183e19cf037
http://eagle.fish.washington.edu/oyster/NMDS%20no%20high%20abundance%20120712.pdf

all proteins: https://www.evernote.com/shard/s242/sh/08eb3fe4-2465-488b-963b-adc9452f25de/c7f19a811b3f42fe8b6ffc6623206731
http://eagle.fish.washington.edu/oyster/NMDS%20all%20proteins%20120712.pdf

To determine which proteins are responsible for differences between oysters, joined all loading files together in Galaxy and annotated with SPIDs (no e-value cut-off). Annotated the NMDS's with protein identifications.
low and high abundance proteins removed: https://www.evernote.com/shard/s242/sh/f81ddfcd-d2fe-4ff4-8345-a61714202594/d7ed7ff37656bff529fa77abdacd965f

low abundance removed: https://www.evernote.com/shard/s242/sh/2a7af91c-9d73-4fe7-879a-22455f3e153c/a133015ab58a4c1894c485a8b439b710

high abundance removed: https://www.evernote.com/shard/s242/sh/5fcb81d6-8923-438e-9c76-3443aa74e659/a60e2f35c117063a2a12e8b88f4eebcb

all proteins: https://www.evernote.com/shard/s242/sh/f8b47757-8074-4c65-b547-cd7d513e861e/c60ba15924730a79f9dff7a2d6576e2c

In the NMDSs for all proteins and only low abundance proteins removed, there is quite a bit of redundancy in the proteins that explain the object (oyster) distribution in space. Even with the simpler plots, however, there does not seem to be a very clear pattern emerging.

December 6, 2012
Secondary Stress: Proteomics
Joined all protein prophet files together and then summed across technical replicates so that each biological replicated is represented by one column. Kept only the proteins that had at least 10 spectral counts across biological replicates. Did 2-tailed, type 2 t-tests in excel to identify proteins of interest for the following treatment groups: effect of mechanical stress in high pCO2 only, effect of mechanical stress in ambient only, effect of mechanical stress over both pCO2 groups, effect of pCO2 over all 16 oysters. Annotated the proteins with SPIDs and descriptions in Galaxy.
70 proteins were differentially expressed in the oysters exposed to mechanical stress (MS) at high pCO2. Some potential proteins of interest include hsp90, hsp70, multidrug resistance protein.
60 proteins were differentially expressed in the oysters exposed to MS at ambient pCO2. Some of these were the same as those differentially expressed at high pCO2, but they were the minority. Some differentially expressed proteins were Toll-interacting protein, cytochrome c oxidase, hsp70
67 proteins were differentially expressed in response to MS across pCO2 treatments. Most of these were differentially expressed in at least one pCO2 treatment.
67 proteins were differentially expressed in response to pCO2 and most of these were not differentially expressed in response to MS. These proteins included stress-induced phosphoprotein 1, v-type proton ATPase, hsp105, cathepsin L.
These combine results produce 219 unique proteins that are differentially expressed due to either pCO2, mechanical stress, or a combination. These 219 proteins will be used to create a protein and peptide tree in Skyline. I will also add proteins to the list from the statistics done yesterday on ambient vs. high pCO2 for a total of 357 proteins.
Downloaded the fasta file of the v9 proteome (local) from crassostreome and uploaded into Geneious. Manually made individual sequence documents for the proteins of interest to export as a single fasta file (C. gigas proteins for Skyline.fasta).

December 5, 2012
Secondary Stress: RNA-Seq
The output file from yesterday is uninformative because there are spaces in the contig names so for each query name it only picked up the first word (Consensus). Reformatted the file so that contig names are Contig1, Contig2, etc. and reran the blastn on the Mac mini with the output file called blastn_isotigs_120512.

Secondary Stress: Proteomics
To compare the effects of elevated pCO2 on the proteome, uploaded all replicates to Galaxy for just high pCO2 (no mechanical stress, samples Exp2.2, 5, 8, 11) and samples for just ambient pCO2 (221, 224, 227, 230). Within each treatment group, joined replicates based on protein identification number. (High pCO2 files were accidentally uploaded into the wrong workflow - C. gigas 3' RNA-Seq.)
Edited the Galaxy files so that they were just columns for total spectral counts for each replicate. Uploaded these files back into Galaxy and joined the 2 pCO2 treatments. Created a file so that each biological replicate (n=8) had just one column which contained the sum of total spectral counts for each protein. Analyzed this data in DESeq just to see what would happen. 56 proteins were "differentially expressed" according to DESeq, all of them downregulated (actually not expressed) at high pCO2 except for 1 protein. Annotated these proteins with SPIDs in Galaxy. Among the proteins down-regulated at high pCO2 were carbonic anhydrase (important for calcification), hsp70, complement component 1Q (immune response), cytochrome c oxidase, dual oxidase (regulated production of ROS).
Did a t-test of the summed total spectral counts to compare expression between the 2 pCO2 treatments (2-tailed, type 2 in Excel). 268 proteins showed differential expression using this method. Annotated the proteins in Galaxy. Removed proteins that had <10 spectral counts across the 8 replicates. This left 168 proteins with a significant t-test p value (<0.05). Most of the same proteins identified by DESeq were shown to be differentially expressed by the t-test method as well, except carbonic anhydrase was just over the threshold of non-significance (p=0.057). Other proteins that were not identified with DESeq were v-type proton ATPase, Toll-interacting protein, uncharacterized oxidoreductase, MAP kinase-activated protein kinase 2, stress-induced phosphoprotein.


December 4, 2012
Secondary Stress: RNA-Seq
Less than 50% of the reads mapped back to the consensus isotigs for each sample (EM2A-EM2H). Of the reads that mapped back, the large majority for each sample mapped uniquely to one isotig.
Exported all 8 RNA-Seq files as csv and resaved them as tab-delimited text files with names e.g. EM2A isotig RNA-Seq.txt. Uploaded to Galaxy. Joined all RNA-Seq files together based on contig number to make file "all isotig RNA-Seq joined". Exported to excel. Removed all isotigs that had less than 10 total reads mapped across all 8 samples - this is the file for DESeq (isotig RNA-Seq for deseq.csv).
Isotig 100818 is differentially expressed.
There is definitely redundancy in the isotigs (i.e. some of them map to the same transcript). I need to remove this redundancy by combining isotigs that map to the same transcript and redo the DESeq.

Exported the consensus sequences from the de novo assembly (the isotigs). Uploaded the fastq file to Galaxy and made it into a fasta file. Saved fasta file to Eagle so that it is accessible from the Mac mini when Eagle is mounted as a server. Created database of Sigenae v8 on the Mac mini by using the following in the Terminal (in the directory ncbi-blast-2.2.27+ in subfolder bin). Downloaded sigenae v8 transcriptome from crassostreome and made it into a database using makeblastdb. Ran blastn using the following code to blast the isotig consensus sequences against the sigenae db with a evalue cut-off of 1E-5, only the top hit returned.
./blastn -num_threads 8 -out [output file directory and name] -db [db directory and name] -outfmt 6 -evalue 1E-5 -max_target_seqs 1 -query [directory and name for isotig contigs] -task blastn
Output file is on Eagle (http://eagle.fish.washington.edu/oyster/blastn_isotigs_120412).

Secondary Stress: Proteomics
Edited all of the Protein Prophet output files so that they can be uploaded into Galaxy.

December 3, 2012
Secondary Stress: Proteomics
I have been uploading raw files into Skyline for analysis. Files were uploading without a problem until I tried to upload 101B_35 (see 11/30/12). I tried a few other files and get the same error. to make sure that it is a Skyline problem and not a file corruption problem, I created a new Skyline session called "test", uploaded one xml file as the library, and imported the 101B_35_01 as a results file. The file uploaded successfully, so there is a problem with Skyline.
Confirmed that the problem is not enough memory in the computer. With more memory I should be able to upload more files. There's also a possibility of partitioning the number of transitions and creating different documents for the different partitions (I'm not really sure what this means or what it would do to my analysis).

Secondary Stress: RNA-Seq
SR has done some work with the 3'-targeted data (see his notebook, Cgigas tag-seq). The idea is to do a de novo assembly to create isotigs and then map the isotigs to the transcriptome using strict parameters.
In CLC, did a de novo assembly of the reads trimmed for quality and virus sequence. Mismatch cost = 2, insertion cost = 3, deletion cost = 3, length fraction = 0.8, similarity = 0.95, vote conflict resolution, ignore non-specific matches, minimum contig length = 75. Saved in folder 'de novo 120312'.
of the 9,283,995 reads, 3,741,778 assembled into contigs with an average length of 95.25 (356,400,475 bases). The total number of contigs assembled = 115,999 with an average length of 126. The number of reads making up the isotigs ranged from 2-1,222,730 (this last is contig 61969). Selected all contigs and "open consensus" to create consensus sequences of the isotigs (saved in the same folder).
Mapped the extracted consensus isotigs to the Sigenae v8 transcriptome. Mismatch cost = 2, insertion cost = 3, deletion cost = 3, length fraction = 0.5, similarity = 0.95, vote conflict resolution, ignore non-specific matches.
Did the same mapping to reference except changed the similarity to 1 and to 0.8. Also mapped to the genome v9 (0.95 similarity).

Sigenae mapping, similarity = 0.95: Out of 115,999 isotigs, 42,647 mapped to Sigenae transcriptome with an average length of 129.64 (26,290 references). Again, it looks like the isotigs mapped all across gene sequences (i.e. they did not fall just at the 3' end). The number of isotigs mapping to a gene ranged from 1-22.

Sigenae mapping, similarity = 0.8: Out of 115,999 contigs, 47,976 mapped to the transcriptome with an average length of 129 (27,971 references). The number of isotigs mapping to a gene ranged from 1-34. Some isotigs mapped just on one end of a transcript (ES789949, DW713967), but many transcripts had isotigs mapping to multiple areas.

Sigenae mapping, similarity = 1: 28,889 isotigs mapped to the transcriptome with an average length of 128.41 (19,466 references). The number of isotigs mapping to a gene ranged from 1-21. Again, it looks like most transcripts had isotigs mapping to multiple areas, not just the 3' end.

genome mapping, similarity = 0.95: 74,149 isotigs mapped to the genome with an average length of 125.53 (1,657 references).

Preparing data to do DESeq. Did RNA-Seq on all the trimmed files, mapping back to the consensus sequences from the de novo assembly. max number of mismatches = 2, min length fraction = 0.9, max number of hits for a read = 10, expression value = RPKM. Saved outputs in RNA Seq folder under de novo 120312.


November 30, 2012
Secondary Stress: Proteomics
Trying to decrease the amount of time and memory it takes to import raw files into Skyline.
Settings > Transition settings > full scan > retention time filtering: use only scans within 5 minutes of MS/MS IDs.. This should significantly reduce the amount of time/memory it takes to import raw files.
This change has significantly reduced the memory the computer uses to import raw files. I will need to go back and change 101B_11 and 101B_32, which were imported without the chromatogram limits.

When I tried to import the file 101B_35_01, I got an error message: Failed to build a cache for "...Sklyine 112812.sky.", Failed to create cache "...Skyline 112812.skyd." Skyline ran out of memory.
From looking at the online help forum, it seems that this message means that there is something wrong with the actual data file.

November 28, 2012
Secondary Stress: Proteomics
Created new library of pepXML files using the v9 interact files (these are filtered for high probability of peptide identification). The library is called "interact" and is made up of all biological and technical replicates. Made changes in peptide settings and transition settings as previously described. In Spectral library explorer, added all peptides to the peptide tree and included the peptides that did not match the filter settings. There are 25,710 peptides total. Saved the Skyline session as Skyline 112812.
Imported raw data files. File > Import > Results > Add single-injection replicates in files > 101B_11_01.
Settings > check Integrate all
Changed peak areas settings as described 11/26/12.
Imported other 2 technical replicates as additional replicates for 101B_11_01.

November 26, 2012
Secondary Stress: Proteomics
Analysis of protein expression in Skyline.
Created spectral library in Sklyline using xml file from 101B_2_01 as described 11/21/12. File used was in the v9 subfolder of 20120821_OT1.
Repeated the same steps to add the spectral library for 101B_2_02 except used the file from the 20120821_OT1 folder (I wanted to see if either spectral library would include annotations for protein IDs, neither did so I deleted this library). Created spectral libraries for 101B_2_02 and 101B_2_03 using the v9 XML file.
Made library for 101B_5 by adding files for all 3 technical replicates. This seemed to work, so created a library called Cg Gill and added all pepXML files to it from v9 folder. This resulted in 0 spectra being found to put in the library. Made a library called 101B with all of the pepXML files from high pCO2 oysters. This library has over 112,000 spectra in it. Saved the Skyline document as Skyline 112612.

File > Import > Results > Add one new replicate: Name 101B_2_01, optimizing none.
Settings: Selected (to check) "integrate all"
View > peak areas > Replicate comparison: right click in window and make sure under Normalize to "none" is checked and Show expected and Show dot products are checked.
File > Import > Results > Add files to existing replicate: 101B_2_01, selected raw file for 101B_2_02. Repeated for 3rd technical replicate.

Emailed with Jimmy and the v9 subfolder contains SEQUEST results from searching the spectra against the genome database. The pepXML files not in that subfolder are from searches against the translated Sigenae database. From here on out, only pepXML files in the v9 subfolder will be used for analyses.

November 21, 2012
Secondary Stress: Proteomics
Analysis of protein expression in Skyline.
Settings > Peptide settings > Digestion: enzyme = trypsin [KR/P], max missed cleavages = 2, background proteome = none.
Peptide settings > Modifications: Carbamidomethyl cysteine and Oxidation (M). Check Variable box.
Peptide settings > Library > Build: name = 101B_11_01, check Keep redundant library, cut-off score = 0.95, lab authority = roberts.fish.washington.edu. Next > Add files: Add the orbitrap mzXML file.
Peptide settings > Library: check 101B_11_01, Pick peptides matching = Library.
individual libraries for each replicate need to be built one at a time.

Settings > Transition settings > Filter: Precursor charges = 2,3,4, Ion charges = 1,2,3, ion types = p, check auto select all matching transitions.
Transition settings > Library: uncheck if a library spectrum is available pick its most intense ions.
Transition settings > Full-scan: isotope peaks included = count, precursor mass analyzer = orbitrap, peaks = 3, resolving power = 60,000 at 400

In spectral library explorer, clicked Add all to add all peptides (357 peptides did not match the current filter settings, chose to include them).

Repeated above steps for 101B_11_02 library.

November 20, 2012**
Secondary Stress: RNA-Seq
Ran experiment in clc on the RNA-Seq (transcriptome) to compare expression between the 2 pCO2 levels. Filtered the data so that only genes remained that showed at least 2-fold difference between the two treatments (~24,000 genes, compared to original 82,000). Exported this file as a .csv. Added column to file that compares expression values using a t-test. Uploaded file to Galaxy and joined with gene annotations of the Sigenae IDs, GO, and GO Slim. Looked through genes that had a p-value (from t test) of less than 0.05 and highlighted genes of interest in yellow. These genes are listed below with an "x" in the column for the treatment in which they are more highly expressed.

Gene	400 µatm	2800 µatm
fibroleukin		x
apoptosis inhibitor 5		x
calcitonin receptor	x
v-type proton ATPase	x
MAPK	x
big defensin	x
acid ceramidase	x

November 19, 2012
Secondary Stress: RNA-Seq
Will try DESeq on the reads mapped to the genome (DESeq done 11/16 was on reads mapped to the transcriptome). For each library (EM2A-EM2H), did RNA-Seq on the clc server, mapping to the genome v9. Minimum length fraction = 0.9, max number of hits for a read = 10, expression value = RPKM. Saved in folder RNA-Seq for trimmed reads (genome).

Exported RNA-Seq files as .csv and uploaded into local Galaxy online. Joined all files together based on scaffold number. Created an input file for DESeq with 1 column for the total reads in each library. Deleted rows that had total reads summing across libraries to <10. (I realize that it doesn't completely make sense to be doing differential expression based on scaffolds because each scaffold represents multiple genes, but I figure that it's a starting point and if I see differences at the scaffold level I can try to bring it down to the gene level.) the file is called "oyster genome for deseq.csv". Output is saved as "C. gigas OA Result Table genome RNA-Seq.csv". None of the scaffolds are significantly differentially expressed, but 4 have an adjusted p-value <1 (and significant p-value): scaffolds 1590, 39732, 42598, and 521.
Figures:
Variance dispersion:
https://www.evernote.com/shard/s242/sh/9215445c-443c-442d-b28b-27acc8a95dfc/8f83c898b2ac54c9fdc9523e3cff8346
Significantly differentially expressed genes would be in red on this plot:
https://www.evernote.com/shard/s242/sh/8e4a611c-0aeb-41ee-9f90-d6ac3e9018b5/868751f74998b939dac886d225afa258
p-value distribution:
https://www.evernote.com/shard/s242/sh/38d2bd7e-1257-40bd-b654-f594c94af1d9/c607524f12aff0960902cbb1bfff899f

November 16, 2012
Secondary Stress: RNA-Seq
Downloaded genes file from oyster genome via crassostreome (local version, oyster_v9_gene.fasta). Mapped reads (quality and virus trimmed) from individual oysters to the gene file using Map reads to reference on server. mismatch cost = 2, insertion cost = 3, deletion cost = 3, length fraction = 0.5, similarity = 0.8, no global alignment, vote conflict resolution, ignore non-specific matches. Mappings saved in Gene Mapping folder.
There were many fewer read matches in the mapping of reads to gene sequences. For example, in sample EM2A out of 1,409,302 reads 106,515 matched when the reads were mapped to genes, 508,285 mapped to the Sigenae transcriptome, and 982,720 mapped to the genome scaffolds.

Redid DESeq with contigs that had at least 10 reads across all 8 samples (n=13,111). The adjusted p-value was still = 1 for all comparisons of differential expression between treatments. See figures from analysis below.
Variance dispersion: https://www.evernote.com/shard/s242/sh/747a7ef2-03b2-4626-b24f-13369f98f8ec/05191a88ee0b205d62770cb878985c9a

Significantly differentially expressed genes would be in red on this plot: https://www.evernote.com/shard/s242/sh/7c34fac2-0e7b-47c5-9349-11d95dbb5064/9968f10465028367bdef30eb26c56c71

p-value distribution: https://www.evernote.com/shard/s242/sh/0ec4cca3-83e5-4116-8a37-0dcd2ebfa514/2275e5c6dc12de5d483b510a6b8d95db

November 15, 2012
Secondary Stress: RNA-Seq
Comparison of expression between treatment groups in clc. Created consensus sequences for all reads mapped to Sigenae v8 by opening the mapped reads, selecting all sequences, and clicking "open consensus". For each consensus sequences did RNA-Seq on the server. Used cgigas_all_contigs_v8 as the reference without annotation. Assembly settings: Max # mismatches = 2, min length fraction = 0.9, max # hits for a read = 10. Expression value set at RPKM. These RNS-Seq files are saved in subfolder under "sigenae mapping" called "RNA-Seq analysis (consensus seqs)".
Did RNA-Seq for the trimmed reads (quality and for virus). Same parameters as above. Results saved in folder "RNA-Seq for trimmed reads". Exported these files as tab-delimited text.

DESeq wasn't loading because I needed to update my R package. R was updated and I was able to load DESeq. Following the user manual (http://bioconductor.org/packages/devel/bioc/vignettes/DESeq/inst/doc/DESeq.pdf), I am putting together an input file and starting my analysis with the files created from the RNA-Seq of the trimmed reads (see above). The expression values in the input file need to be raw counts of sequence reads (total reads in clc terminology). The rows of the file should be individual transcripts and each column should be the expression values for a sample. Made this file in Galaxy by joining all of the RNA-Seq files together. Removed all rows that had 0 expression across all samples, formatted cells as "general" (otherwise R does not recognize cell contents as numbers), and saved as csv file "oyster for deseq".

November 14, 2012
Secondary Stress: RNA-Seq
Added sequence for virus PhiX174 as adapter to be trimmed since it is possibly part of the sequence information. Eli sent a file with its genome sequence. In clc: Edit > Preferences > Data. At the bottom of the adapter trimming table, click "Add row". Adapter is called Illumina phiX, entered entire genome as sequence, strand=plus, alignment score = 2,3,10,4, action= remove adapter. Eli also said that "GGG" or "GGGG" may be present at the 5' end of some of the sequences, but I'm not sure how to tell clc to only trim "G" repeats at the 5' end and Eli said it shouldn't be a problem. Saved these trimmed reads in the folder PhiX trimmed. ~100% of the original reads were still present after trimming, meaning that there was not much virus sequence in the reads.

Downloaded cgigas_all_contigs_v8.fa to use as reference for assembly of trimmed reads (Sigenae transcriptome). Mapped the doubly trimmed reads to the transcriptome (individually) and saved in Sigenae mapping folder: mismatch cost = 2, insertion cost = 3, deletion cost = 3, length fraction = 0.5, similarity = 0.8, no global alignment, vote conflict resolution, ignore non-specific matches.

Exported mapping file (.sam) for EM2B to Eagle. Uploaded to local Galaxy on the web and named EM2B Sigenae. Visualized in Trackster using Sigenae contigs v8. There was an error in visualization, so redid the same steps on the public Galaxy website.

Exploring IGV: downloaded IGV from website. Loaded C. gigas Sigenae v8 as a "genome" in IGV by selecting Load genome from URL from the File menu. Downloaded EM2B file mapped to Sigenae and created index file in igv: File > run igvtools, command = index, browse for file and hit run. Index file is saved in same folder as .sam file. Loaded .sam file into IGV by going File > Load File. Contigs can be viewed individually with mapped reads. The multicolored bar at the bottom of the screen is the contig sequence, the gray bars are the mapped reads. The colors in the gray bars are SNPs between the reads and the contig.
See IGV view here:
https://www.evernote.com/shard/s242/sh/05aa2bb4-441b-4655-9976-3e479c98fb91/0076c89fc20d887a4b05fc94f11e106c

Decided to go ahead and try to do RNA-Seq to see what happens. I would like to try this in the R package DESeq. I tried to install DESeq but it seems that the website is currently down (I found on a discussion board that this is likely to happen). I'll try to install it again tomorrow.

November 13, 2012
Secondary Stress: RNA-Seq
The local Galaxy mapping started on the Mac mini on Nov 7 is still running.
Downloaded and unzipped files on the PC in the lab to start workflow in clc. Logged into clc server and created directory: C. gigas OA RNA-Seq. Imported sequence files (EM2A-EM2H) into this directory by importing high throughput sequencing files and choosing Illumina as the data type. Also imported oyster.v9_90 genome file to use as reference (this was imported just through the normal file import).
Mapped EM2A to oyster genome v9. Parameters were: mismatch cost =2, insertion cost = 3, deletion cost = 3, length fraction = 0.5, similarity = 0.8, no global alignment, vote conflict resolution, random non-specific matches. Saved mapping in sub-folder EM2A (this mapping was done locally). Queued EM2B-EM2H to map to the reference with the same parameters but on the server.
Exported mapped reads at .sam files and uploaded to Galaxy. In Galaxy, .sam files can be converted to interval files and then to BED files. (We discovered that sam files have the same depth info as bed files so the conversion may not be necessary.) Both sam and bed files can be visualized in Trackster (saved visualization as EM2A SAM1). Saved oyster.v9_90 as a reference genome in Galaxy. Viewed sam and bed files with genome as reference. Added oyster v9 annotations for CDS (exons) and mRNA (gene sequence, probably does not include UTR) as tracks in the visualization. A lot of the reads seem to fall into improbably areas on the gene. We will try mapping cleaner reads to the transcriptome (from Sigenae).
Example of visualization:
https://www.evernote.com/shard/s242/sh/e5261617-2ed7-43c9-a7a7-79e72db5d705/0a8e9fc59b201a0a8f26bc5ddd60c6ef

Quality trimmed the reads in clc: trim using quality scores, limit = 0.05, trim ambiguos nucleotides, maximum number of ambiguities = 2, discard reads less than 50. About 70-75% of the reads for each sample were retained after trimming (see below). Mapped these trimmed reads to the genome. Next steps: remove barcodes and other excess sequences.
Trim report:
https://www.evernote.com/shard/s242/sh/4bbfb2be-3afa-478a-aa89-fac20a77e145/5704e8d29c98a658396bd609fce14c6e
https://www.evernote.com/shard/s242/sh/eeb61897-f3c8-462e-9927-214170636888/9ade273133af8f8ab5db524995dae33d

November 7, 2012
Secondary Stress: RNA-Seq
Data from NGS run by Eli Meyer is on Eagle (http://eagle.fish.washington.edu/oyster/gigas_rnaseq.tar.gz). The sample IDs are explained in the table below. Began analysis of sequence data on local Galaxy on the Mac Mini. Created an admin account on the mini and opened terminal to launch Galaxy. In terminal, entered the following code:
cd /Users
cd Shared
cd Apps
cd galaxy-dist
./run/.sh
Opened a web browser and entered address: localhost:8080
Username for the local Galaxy is my gmail address.
Saved unzipped fastq files in Documents on Mac mini and also on my laptop. Uploaded the first file (EM2A.fastq) to Galaxy on the mini. This is taking a really long time, so decided to start running on Geneious on the mini.

Geneious:
Downloaded C. gigas genome from crassostreome (oyster.v9_90, fasta file) and uploaded into Geneious. Also uploaded EM2A. Mapped EM2A sequenced to genome reference. Sensitivity = medium-low sensitivity/fast, fine tuning = none (fast/read mapping), no trimming sequences, saved in sub-folder, and saved contigs...Oops, not enough memory to perform the assembly.

Local Galaxy:
Uploaded oyster.v9_90 to galaxy as well. Named history "C. gigas 3' RNA-Seq". Made oyster genome into a reference sequence: under "Visualization" at the top of the page, chose new visualization, and then clicked add a custom build. Named the reference "C. gigas genome v9". Uploaded other fastq data files into history. Under tool heading "NGS: QC & manipulation" used the FASTQ to FASTA converter to make all files FASTA.
Mapped EM2B to the reference genome using the NGS Mapping tool Lastz (for mapping short reads to a reference). Output = tabular, commonly used settings, mapping mode =Illumina 95% identity, ept min and max reporting and coverage reporting the same (0, 100, 0).

Meyer ID	BC #	ETS ID	pCO2
EM2A	BC1	Exp2.1	2800
EM2B	BC51	Exp2.4	2800
2C	52	7	2800
2D	53	10	2800
2E	57	217	400
2F	58	220	400
2G	54	235	400
2H	55	238	400

October 31, 2012
Bioinformatics: Pinto Ab NGS
Oly SRA files were successfully transferred the second time. The correct accession number for the Oly and Pinto RNA-Seq data is
SRA057107.

October 30, 2012
Proteomics: Analysis for Manuscript
Compared protein identifications across technical replicates. Created csv file tech reps for plotting which has a column for each technical replicates across all 4 biological replicates. Each cell with a number in it for a technical replicate means that protein was identified in that particular injection (proteins are listed in the far lefthand column). The matches across replicates were summed in the far righthand column and all columns were sorted based on number of matches. Graphed in R, color coding for biological rep (https://www.evernote.com/shard/s242/sh/47cb9fd2-873e-4ac9-a238-61220a48e04f/548adcdfa1cd42c0ca3963457e4062b9).

Plotted average spectral counts (proxy for protein expression) versus the number of times that protein was identified (or number of matches). The csv file is called spec counts tech reps (https://www.evernote.com/shard/s242/sh/092028b9-8e41-40fd-aeaa-701e31af3c77/324139ae3e2e0e5673fa76375a88590a). Did the same plot but using total spectral counts instead of average and got same result (not shown).

October 29, 2012
Proteomics: Analysis for Manuscript
These analyses were done only for the Orbitrap data.
Used Venny to create a Venn diagram comparing proteins expressed across biological replicates. From excel file ambient gill proteome joined to all replicates, got the list of protein IDs for expressed proteins for each oyster. For every protein that was expressed per oyster, copied the list into Venny.

Compared the 10 proteins that are expressed the most highly across biological replicates. From average spectral counts across technical replicates, determined which proteins were in the top 10 for each oyster. Protein annotations are provided by SPIDs. No oyster had a unique protein in this category. 8 proteins were included in the top 10 across all oysters.

Bioinformatics: Pinto Ab NGS
Got an email informing me that the Oly SRA files uploaded to NCBI were corrupted (original upload done August 10, 2012). Downloaded the fastq files again (
http://eagle.fish.washington.edu/whale/index.php?dir=&sort=date&order=desc). Files were renamed Olurida_R1 and Olurida_R2. In SRA submission, flow cell and lane numbers were kept the same (since it is the same data). Generated new checksums using MD5 software. Transferred files using FileZilla 2.

October 4, 2012
Secondary Stress: Fatty acids
Through conversations with Louise Copeman (NOAA, Newport, OR) and Michael Brett (UW) I've been learning a little bit about fatty acid analysis and what it can tell me about oysters and ocean acidification. Louise suggested that I investigate lipid class analysis as well as/instead of FA because it gives a good condition index (look at total lipid, storage vs. membrane lipids). She is set up to do this at OSU. If I did the extractions myself, lipid class analysis would be ~$80/sample and FAs would be $40/sample.
Michael Brett thinks that FAs can still give me some very useful and interesting information. FAs give insight into nutritional physiology and the quality of nutrition that an animal is getting. Lipid class tells you more the quantity of lipids being stored and which lipids are being stored. (During a FA analysis lipids are methylated so you don't know where they came from.) Lipid class analysis would should where the FAs end up and could answer the question: does OA affect the oyster's ability to withstand periods of low food? If I were to do FA with the Brett lab and do the work myself, it would cost $15/sample.

October 2, 2012
Bioinformatics: Pinto Ab NGS
Steven ran blast comparisons of both transcriptomes vs. Lottia gigantea proteins yesterday. In OrthoDB, got conserved proteins across all metazoans with a single copy in Lottia. SR did a tblastn of O. lurida and H. kamtschatkana contigs against this db of protein sequences (30 Lottia sequences total). O. lurida had 28 matches with an e-value less than 1E-5 and H. kamtschatkana had 2 matches.
For each contig that matched to a L. gigantea protein, translated in all 6 frames using standard sequence translation (Geneious). Aligned all 6 translations with the protein sequence: Geneious alignment, cost matrix = BLOSUM 6, gap open penalty = 12, gap extension penalty = 3, global alignment with free end gaps, 2 refinement iterations. From the alignment, determined the correct translation. Calculated the % of the protein that is covered by each sequenced contig.
Calculated # of SNPs per contig. SR had a table of all SNPs (http://aquacul4.fish.washington.edu/~steven/armina/OlyOSNPsAnnotated.txt and http://aquacul4.fish.washington.edu/~steven/armina/HkamSNPsAnnotated.txt). Downloaded table, put contig names in a column and made pivot table of column of contig names. Since each snp is a unique entry, a contig with multiple SNPs is entered multiple times. Took the average of the number of occurrences of/SNPs in each contig. for O. lurida this is 3.04, for H. kam this is 1.95.

October 1, 2012
Bioinformatics: Pinto Ab NGS
Computed contig lengths for assembles of Pinto and Oly transcriptomes to create histograms. Imported assembled contig FASTAs into Galaxy and used tool "compute sequence length" under FASTA manipulation. Kept all title characters. Exported contig length files (one column = contig name, second column = each contigs length) and made histograms in R.

Proteomics: Analysis for Manuscript
Uploaded protein prophet files to server for archiving. Server address is afp://128.95.149.204. Mount "web" to archive data. Created folder "oyster" and subfolder "proteomics" and copied all data into proteomics. Can be found here: http://128.95.149.204/oyster/index.php?dir=proteomics%2F

September 28, 2012
Proteomics: Analysis for manuscript
Did analysis of technical replicates to visualize variability with samples. For each oyster (103 B 221, 224, 227, 230), averaged the total number of independent spectra into a column called "average spectra". Created a csv file for R with protein name, total independent spectra for each technical replicate, and average spectra. Sorted all columns by average spectra, larges to smallest. Plotted each column of total independent spectra: replicate 1 = black, rep 2 = blue, rep 3 = green. Below is the plot for 103B230.


Bioinformatics
Downloaded new SwissProt associations database for annotations (SwissProt IDs linked with gene descriptions/annotations). Went to EMBL website and clicked on UniProtKB.

September 24, 2012
Proteomics: Analysis for manuscript
Downloaded proteome from the genome sequencing webpage. SR annotated the proteome with SwissProt IDs with an e-value cut off of 1E-10.
Jimmy re-ran SEQUEST searches of Orbitrap (OT) and QExactive (QE) data against the new database. downloaded all files with protein probability of at least 0.9. Further analysis is only on proteins from 103B 221, 224, 227, and 230 (ambient, not mechanical stress). All protein prophet files were annotated with SPIDS and joined to the proteome downloaded from the genome.
Made file of proteome for just the samples being analyzed (proteome 2). This is a list of unique contigs representing all the proteins sequenced in the triplicate injections of the 4 samples. Proteins are included only if they have at least 4 spectral counts across samples (1,672 proteins).
Using DAVID v. 6.7 did enrichment analysis of gill proteome sequenced vs. entire proteome downloaded.
Also did enrichment analysis of each oyster (across replicates) vs. proteome 2 to compare inter-individual variability. For all revigo files downloaded, they are the tables from the Gene Ontology BP FAT.
Visualized entire gill proteome by joining to GO terms, filtering out unique entries of contig-GO combinations, and putting in revigo. The number used in revigo was number of spectral counts across oysters/replicates.
April 6, 2012
Mukilteo water chem
Sammi made new dye this morning. I did spec pH of incoming water and 1 tank from lab, GHA and GHB. Also did dye correction for new dye.

March 21, 2012
Secondary stress
Met with Peter Westley (Quinn lab) to talk about using ImageJ to quantify shell corrosion on the inside of shells. He thinks I should use the polygon function to measure the total shell pixel area and the area of the white spots. To take better pictures, he suggests using a regular digital camera attached to a stand so that it is parallel to the bench top. Put the oyster shell on a white background (probably use only the flat valve to minimize problems with glare), include a scale of some sort, and light with a couple of regular desk lamps. Try to take a picture with the maximum resolution - raw if possible, or tiff, try to make the pictures 4 MB.

March 20, 2012
Secondary stress: proteomics
Retrieved blastall file from 3/15/12 (saved as Galaxy 36 blastall results.xlsx in proteomics folder). Edited file so that there are only 3 columns: Sigenae ID, Swissprot ID, and e-value and uploaded into Galaxy (file 43). Joined this file with GO annotations using Swissprot IDs (Galaxy 44) and then joined with GO Slim terms (Galaxy 45). This file was exported and is called: Galaxy 45 - annotated proteins from blastall.xlsx. Sorted by GO type so that only biological processes were left and then sorted by e-value (cut off =1e-5). Made pivot table from GO slim terms.


Mukilteo water chem
Did spec pH of 9 Muk water samples: incoming water and 2 tanks for each GHA, GHB, and lab.
Also did dye correction of dye made 3/19/12.

March 19, 2012
Mukilteo water chem
Made new m-cresol purple with 0.032 g dye in 40 mL nanopure water. Adjusted pH so that A1/A2 (578/434) ~1.6 (really about 1.43). Next, time start with just 1 drop of 5N NaOH.
Did spec pH of 3 Muk water samples: incoming water for GHA, GHB, and lab.

March 16, 2012
Mukilteo water chem
Spec pH of incoming water for Greenhouse A (GHA), Greenhouse B (GHB), and lab, and one tank from each location as well (total = 6). Sammi had made the dye and done dye correction 3/6/12. Files are saved on Friedman lab computer in 236.

March 15, 2012
Secondary stress
Analysis of size data (t0 and t 1 month) for Experiment 2, 1 month OA exposure.
Did a linear regression of shell weight on buoyant weight since for t0 we only have BW and for t1mo we have both weights. BW (adjusted for forcep mass) is a decent predictor of shell weight via the eqn: y=0.8329(x)+0.2581. Buoyant weight and total weight are also highly correlated, as are shell weight and total weight. Lenght, width, and LxW are not well correlated to BW.

Based on a one-way ANOVA with pCO2 as the fixed factor, there is no difference in shell weight (using BW as a proxy) within treatments at either time point or across time points (t-test was used for the latter).

Secondary stress: proteomics
From file Galaxy 36-annotated proteomics, took all Sigenae IDs that had a nsp-adjusted probability of at least 0.9 and retrieved contig sequences from Sigenae, this file is contigs for galaxy 36 proteins. Sigenae only returned 571 contigs out of 604 total. Did a blastall in wetgenes (blastx against swissprot db).

In Galaxy, joined the Sigenae ID columns in the Galaxy 36 dataset with GO annotations (Galaxy 41). Then joined with GO Slim terms (Galaxy 42) and exported file (Galaxy 42- Go annotated proteins.xlsx). These data were filtered for nsp-adjusted probability of at least 0.9 and biological process GO category. The resulting GO Slim terms were put into a pivot table.


March 13, 2012
Secondary stress: proteomics
Explanation of how ProteinProphet produces a protein probability - from Nesvizhskii et al. 2003.
Background of protein sequencing and identification: Proteins are cleaved (by trypsin) and the complexity of the peptide mixture is reduced by chromatography separation. After this separation, the mixture is subjected to reverse-phase chromatography coupled with mass spec. Peptides are ionized and ions are subjected to fragmentation to produce tandem mass spectra. The spectra are entered into a database search (e.g. SEQUEST). Such programs create a theoretical database of spectra based on the protein sequences so that the data (spectra) from the mass spec are actually assigned to these theoretical spectra that correspond to an accession number in the db. SEQUEST creates a Qscore (kind of like an e-value) that takes into account the total number of identified peptides in the data set and the number of peptides that correspond to each protein. This QScore and the peptide sequence are the inputs into ProteinProphet.
degenerate peptide = sequence is present in more than a single entry in the database, in ProteinProphet degenerate peptides are assigned to all of their hits (degeneracy is usually due to db redundancy)
probability of observed data being correct (p(+|D)) = the model learns to distinguish correct and incorrect peptide assignments based on the particular db and so computes a probability for each peptide assignment being correct. By using the data itself to "learn", the method is robust to sample purity, mass spectral quality, proteolytic digest efficiency, etc.
Number of sibling peptides = if a peptide is part of a "multihit" protein (high coverage) then it has a high NSP. NSP is the expected number of other correctly identified peptides corresponding to the same protein.
Combining p(+|D) and NSP: If a single hit peptide has a p(+|D) close to 1, then it is penalized less for its low NSP.
Example data using ProteinProphet: all probabilities of at least 0.99 were correctly assigned and only 3 were incorrect at >0.9. 92% of correct peptide assignments have NSP > 5, majority of incorrect assignments have NSP < 0.25. More MS runs of the same data increases coverage so that more correctly identified proteins are multihit (have a large NSP).

March 12, 2012
Secondary stress: proteomics
Explanations of protein output data (also found at ).
weight: contribution of peptide among each of multiple sequence entries, * = unique entry
nsp adjusted probability: probability is adjusted based on number of sibling peptides found for that protein (the greater the number of sibling peptides, the greater the probability)
Initial probability: probability assigned by ProteinProphet without regard to corresponding protein
NTT (number of tolerable termini): 0, 1, or 2 expected cleavage termini
nsp bin: 0-7, # of sibling peptides after discretization
total: number of instances peptide was identified in dataset
peptide group indicator: independent evidence of peptide identity if found in different charge states (also indicated in column)
group probability:
protein probability:
percent coverage:
number unique peptides:
percent share of spectrum IDs:
description:
nondegenerate evidence:
precursor ion charge:

Made a list of just the Sigenae contig numbers that corresponded to the sequenced proteins and joined this list with a file of Sigenae contig numbers with their top blast hit to a protein (Galaxy 5 Cg Sigenae 8 best hits). This essentially annotates the list of proteins that were sequenced. Exported the file from Galaxy and removed all proteins that didn't have a clear annotation - i.e. deleted all that were simply "hypothetical" proteins or predicted proteins without a function. This file saved in excel workbook Galaxy 32 - annotated proteins 031212.
Took ProteinProphet output file (proteomics output first gill sample.xlsx) and edited it so that each protein was on one row. An extra column was added so that Sigenae ID has only the first ID and all IDs are in a separate column. Saved as a text file and joined with Sigenae 8 best hits in Galaxy. Saved as Galaxy 36-annotated proteomics.xlsx.

February 29, 2012
Secondary stress
Brought over one sample (Exp2.218, posterior gill from control, tank 103B1) to Byron Gallis at the mass spec facility in Health Sciences (School of Medicinal Chemistry). He is going to prep and run the sample on the MS for proteomic sequencing.

February 28, 2012
Secondary stress
Sorted tubes from Experiment 1 today. Exp.1-200 were divided between 2 boxes so that odd number tubes are in one box and even in the other (NB: Exp1.199 is out of order because one spot was skipped). This should divide up duplicate samples for oysters since 2 gill samples were taken in consecutive tubes for each animal. Heat shocked samples (collected 1/20/12) are in their own box and LHT are in one half with SLT+LHT in the other half (except for 103B LHT2, which is in the overflow box). Exp1.201-249 are in a fourth box.
I also organized all the samples from Experiment 2 (1 month exposure). Samples are divided between boxes by tissue type: anterior gill, posterior gill, and whole body. It appears that there never was a tube Exp2.387 so the sample sheet will be adjusted accordingly.

February 18, 2012
Secondary stress
Labeled tubes and made sample sheets for last day of experiment, 2/19/12, when Carolyn and Steven are going to sample the oysters.
Took spec pH of source water for all treatments. Spec pH is corrected for temperature (13 or 20°C) using a TA of 2095 µmol/kg.

Tank	Durafet_pH	salinity	spec_pH
101A	8.04	29.6	8.032
102A	7.64	29.6	7.593
102B	8.02	29.6	8.014
103B	8.01	29.6	8.035
104A	8.05	29.7	8.013
104B	7.70	29.7	7.684

HS mortality (checked by SR in the pm): 1 hot pink dead in 102B4 (l=49, w=40, shell weight = 6.59 g)

February 17, 2012
Secondary stress and Multispecies OA
Counted morts of geoduck, small C. gigas, and large C. gigas.
Took spec pH of all source water. Messed up the 101A sample so do not have pH data for it. Also somehow forgot to record the salinity and Durafet pH data, so salinity is estimated to be 29.7 ppt. Spec pH is corrected for temperature (either 13 or 20°C) using a TA of 2095 µmol/kg.

Tank	spec_pH
102A	7.612
102B	8.045
103A	8.012
103B	8.057
104A	8.030
104B	7.683

February 16, 2012
Bioinformatics
The focus of my analysis is now going to be completely on gene discovery. I am going to do a comparison of gene discovery using a de novo assembly vs. a backbone assembled from available H. asinina reads.
De novo assembly of trimmed reads: reads assembled to create 9,301 reference sequences. Exported pdf of mapping summary report. Opened de novo and selected all contigs and chose "open consensus". Exported FASTA file of consensus sequences.

Reads mapped back to H. asi backbone: did the same as above - extracted consensus sequences from 1122 references and exported FASTA file. (NB: these are still the untrimed reads)

For both files of consensus sequences, imported into the SAFS Inquiry portal to do a blastall. Blastall run with same parameters as Jan 9, 2012: blastx against swissprot db, etc.

Workflow for results from H.asi backbone:

• opened blastall file in excel and separated columns by "|"; made sure there were no gaps in the data (saved as blastall Hasi backbone.txt)
• uploaded into galaxy and joined with the uniprot swissprot IDs file based on swissprot IDs (1st column in uniprot file, 5th in blastall file) = job 20; kept unmantching and incomplete lines
• joined resulting table (column 5) with swissprot associations file (column 2) - couldn't keep unmatching and incomplete lines because kept on getting an error = job 23
• joined resulting table (column 25) with GO to GO Slim file column 1, keeping unmatching and incomplete lines = job 24
• exported into excel and saved as Galaxy Hasi backbone.xlsx
• Made a tab with the data filtered for only biological processes
• filtered the biological processes to those with evalues less than or equal to 1e-5 in a new tab
• Used the GO Slim terms to make a pivot table and pie chart of the processes discovered (see below)
• exported unique swissprot IDs from the blastall file to DAVID as the background list and exported the filtered (biol process, e-value cut-off) unique list of IDs as the gene list. Used the functional annotation tool, selected Gene Ontology, and exported the GO_TERM_BP FAT file. (see below)
• Pasted GO terms with associated p-values into revigo.

Workflow results for de novo assembly (same as above but differences are noted):

• blastall file - blastall de novo.txt
• join with uniprot/swissprot IDs= job26
• join with swissprot associations=job 27
• join with GO to GO slim file = job 28
• saved as Galaxy de novo.xlsx

Secondary stress
Cleaned tanks and counted mortalities.
From 43°C HS (tank 102B) the following are dead: hot pink (102B3), yellow and dark pink (102B4), and red (102B5). From 44°C HS the following are dead: hot pink and dark pink (103A1), hot pink (103A2), seafoam and turquoise (103A3), turquoise and yellow (103A5), dark pink (103A7). All oysters dead from yesterday and today were measured (length and width), shucked, and shell weight was taken.
Durafet probes were calibrated for temperature. Spec pH was taken of all source water and is corrected for temperature (13°C) with a TA of 2090 µmol/kg.

Tank	Durafet_pH	salinity	spec_pH
101A	8.01	29.6	8.043
102A	7.68	29.7	7.654
102B	8.02	29.6	8.035
103A	8.03	29.7	8.034
103B	8.04	29.7	8.080
104A	8.05	29.9	8.037
104B	7.69	29.8	7.689

Multispecies OA
All tanks were cleaned (I cleaned Oly tanks, Dave cleaned multispecies tanks). Geoduck morts were counted and photos put in dropbox: 3 in 102A3 (1 crushed), 2 in 102A6, and 1 in 102A4. Small C. gigas morts were 1 each in 101A5 and 102A6. See above for spec pH (Oly pH is corrected for temp of 20°C).

February 15, 2012
Bioinformatics
The RNA-Seq says that it "ended abnormally" so I guess that means it didn't work. Mapping reads (both libraries) back to reference (H. asi backbone) to make sure that there are actually sequences in common between them.
Started work flow for trimmed sequences (that SR had trimmed). Summary of SR trimming:

Name	Numberofreads	AVg.length	Numb.reads.after.trim	percentag.trimmed	avg.length.after.trim
high CO2	41,027,557	36.0	40,816,572	99.59%	35.9
ambient	54,101,070	36.0	53,961,227	99.74%	36.0

Removal of low quality sequence limit = 0.05
removal of ambiguous nucleotides: maximal 2 nucleotides allowed
removal of sequences on lenght: min length 25 nucleotides
De novo assembly of 2 libraries of trimmed reads (all saved within "SR" directory under trimmed sequences): mismatch cost = 2, limit = 8, fast ungapped alignment, vote conflict resolution, random non-specific matches, min contig length = 200, map reads back to contigs (create summary report).

Secondary stressor and Multispecies OA
Took spec pH of all source water and containers 5 and 6 for every treatment. Took TA of all source water and of containers 5 and 6 for 104 A and B (Olys) and 101A and 102A (Multispecies OA). Spec pH in the table is corrected for temperature (13°C for all except 20°C for 104A and 104B) using the given TA.

Tank	Durafet_pH	salinity	spec_pH	TA
101A	8.00	29.7	8.027	2093.01
102A	7.66	29.7	7.604	2091.32
102B	8.02	29.7	8.046	2091.92
103A	8.04	29.9	8.032	2090.77
103B	8.03	29.9	8.067	2091.02
104A	8.05	29.9	8.042	2092.84
104B	7.69	30	7.69	2093.12

Geoduck mortality from HS 2/10/12: 101A1 (1), 101A5 (1), 101A6 (3), 101A7 (1, 100% mortality), 102A4 (1), 102A6 (1, crushed), 102A7 (1), 102A8 (3, 100% mortality). Took pictures and put in Friedman lab dropbox.
Small C. gigas mortality: 101A5 (1), 101A6 (1).
Secondary stress C. gigas mortality for 44°C:

Tank	101B(hot_pink)	102B(turquoise)	103A(yellow)	103B(dark_pink)	104A(sea_foam)	104B(red)
103A1		x	x		x	x
103A2		x	x	x	x
103A3	x		x	x		x
103A4	x	x	x	x	x	x
103A5	x			x	x	x
103A6	x	x	x	x	x	x
103A7	x	x	x		x	x
103A8		x	x	x	x	x

Secondary stress C. gigas mortality for 43°C: red in 102B4 and dark pink in 102B5.
Saved all the morts in the freezer to get measurements and shell weights tomorrow.

February 14, 2012
Bioinformatics
RNA-Seq from 2/7/12 seems to have not worked so repeated steps to do RNA-seq for both libraries agains the H.asi backbone.

Secondary stressor
The electricity was turned off this afternoon for about 15 minutes around 1:30 pm. When it came back on all the controllers were in manual mode and so the pH went up for all the treatments to 8.1-8.2. They were set back to auto around 3:30 pm.
All tanks were cleaned. There were no mortalities although many of the oysters from the 44°C HS were slow to close their valves upon emersion (lethargic).
Took spec pH of all source water. Spec pH is corrected for temperature (13°C except for 104 A and B which are at 20°C) using a TA of 2095 µmol/kg.

Tank	Durafet_pH	salinity	spec_pH
101A	7.99	29.7	7.990
102A	7.63	29.9	7.551
102B	8.01	29.8	8.034
103A	8.00	29.7	7.999
103B	8.03	29.9	8.081
104A	8.02	29.9	8.009
104B	7.65	29.8	7.668

Calibrated Durafet probe for pH: 102A down 0.08 units

Multispecies OA
Did geoduck mortality checks and sent photos of dead ducks to Carolyn. Also did C. gigas mortality checks. There was 1 C. gigas dead in the following containers: 101A5, 102A6, 102A2, 102A5.
20°C set points for 104A (400 ppm) and 104B (1000 ppm) using TA of 2095 µmol/kg and s of 29.8 ppt: 104B = 7.683, 104A = 8.037.

February 13, 2012
Multispecies OA
One mortality of C. gigas: 400 ppm, 43°C bag 5
New set points for Oly tanks (104A and 104B) at T of 17°C, s = 29.9 ppt, TA=2095 µmol/kg: 400 ppm = 8.036, 1000 ppm = 7.678 (adjusted pH set points accordingly). Put tanks at 18°C in the evening.

Calibrated new batch of acid that I made last night. New concentration is 0.09608 N.
Did spec pH of source water for all tanks. Spec pH is corrected for temperature (13°C for all except for 104 A and B, which are 15°C) using a TA of 2095 µmol/kg.

Tank	Durafet_pH	salinity	spec_pH
101A	7.99	29.7	7.998
102A	7.64	29.8	7.582
102B	8.06	29.8	8.043
103A	8.02	29.7	7.992
103B	8.02	29.9	8.021
104A	8.01	29.9	7.997
104B	7.65	29.9	7.637

Calibrated Durafet probes for temperature on all tanks.

Secondary stressor
No mortality from HS.

February 12, 2012
Multispecies OA
No mortality from HS 2/12/12 for small C. gigas.

Secondary stressor
Heat shocked oysters - 1 oyster from each container (n = 8) per treatment at each temperature: 42, 43, and 44°C. Oysters were randomly taken from each container measured (length, width), weighed (total weight and buoyant weight) and labeled with nail polish corresponding to the treatment from which they came. HS was comprised of a 10 minute warm-up followed by 1 hour in 800 mL of heated seawater. The same water was used for 42 and 43°C, but the water was changed for 44°C. After HS, the oysters were all returned to ambient conditions (pH = 8.03, T = 13°C) for observation over 1 week. In each container, there is one oyster from each treatment. Oysters HS'd at 42°C are in 103B, 43°C are in 102B and 44°C are in 103A. Time that HS occurred was also recorded.
Put all histo samples in 70% EtOH.

February 11, 2012
Secondary stressor and Multispecies OA
Sampling day! Sampling began around 8 am and ended around 3 pm. From each of the 6 pCO2 treatments, oysters were sacrificed in 3 groups of 8 (1 from each container in each group of 8). The first group was sampled as controls, the second group underwent mechanical stress and the third group was another control. After being removed from their containers, each oyster was measured (length and width) and weighed (total weight and buoyant weight). Oysters were then shucked by Mac who also sampled the anterior gill and poster gill lamellae (in 2 separate tubes). Steven took a cross-section that included digestive gland and gill and a slice of the adductors muscle, which were immediately fixed in Invertebrate Davidson's solution (oysters from 101B and 102B sections were not fixed right away, all 8 were stockpiled until the end and then all put in the fixative at the same time). SR then put the remaining body in a third tube. I removed excess tissue from the shell, dried the shell, labeled both valves, and weighed the shell. The shells were saved in large weigh boats to air dry. For the control oysters, after measurements were taken the oysters were left sitting on the lab bench for 5 minutes before sampling. For the mechanically stressed oysters, after measurements all 8 oysters were spun together in a salad spinner (by Ro) for 5 minutes, after which they were immediately sampled. All samples were flash frozen in liquid nitrogen and stored at -80°C.

February 10, 2012
Secondary stressor and Multispecies OA
Cleaned feeding lines by flushing with fresh (DI) water and then salt water.
Calibrated temperature probes.
Small C. gigas HS mortality: 3 at 43°C (90% mortality).
Heat stressed small C. gigas: randomly picked one from each container and heat shocked 2 groups at each temperature per pCO2 treatment at 41, 42, and 43°C.
Took spec pH of all source water. Spec pH is corrected for temperature (13°C) using a TA of 2090 µmol/kg.

Tank	Durafet_pH	salinity	spec_pH
101A	7.99	29.5	7.989
101B	7.36	29.4	7.400
102A	7.65	29.5	7.571
102B	7.85	29.5	7.871
103A	7.60	29.6	7.631
103B	8.03	29.6	8.029
104A	7.74	29.6	7.778
104B	7.65	29.6	7.645

February 9, 2012
Secondary stressor and Multispecies OA
Sampled C. gigas for Carolyn's experiment: 1 oyster from each container, sampled mantle, gill and whole body and measured length, width, total weight, buoyant weight, and shell weight.
Took spec pH of all source water from each of the treatments. Spec pH is corrected for temperature (13°C) using a TA of 2070 µmol/kg.

Tank	Durafet_pH	salinity	spec_pH
101A	7.95	29.4	7.942
101B	7.51	29.3	7.512
102A	7.58	29.3	7.600
102B	7.84	29.3	7.875
103A	7.59	29.3	7.632
103B	8.05	29.4	8.044
104A	7.74	29.3	7.769
104B	7.64	29.4	7.643

Calibrated Durafet probes for temperature.
Turned off feeding for 101A and 102A in the morning so that the animals would not be fed right before their feeding trial. Turned the pumps back on for evening feeding.
Geoduck HS mortality: 1 at 22°C
Small C. gigas HS mortality: 4 at 43°C, 2 at 44, 4 at 45.
Cleaned all containers for the secondary stress experiment (i.e. did not clean 101A or 102A).

February 8, 2012
Secondary stressor and Multispecies OA
The breaker is getting fixed today so the electricity shouldn't short out anymore.
Ran TA and spec pH for all source water and containers 1 and 2 for each treatment (container 2 was poisoned and archived for later TA analysis). Spec pH is corrected for temperature (13°C) using the TA that was measured for the source water of each cooler.

Tank	Durafet_pH	salinity	TA	Spec_pH
101A	8.03	29.5	2069.72	8.015
101B	7.40	29.5	2069.96	7.419
102A	7.69	29.5	2071.4	7.629
102B	7.87	29.6	2070.99	7.892
103A	7.57	29.5	2072.1	7.638
103B	8.04	29.6	2071.87	8.047
104A	7.74	29.6	2076.24	7.775
104B	7.64	29.7	2074.87	7.670

Geoduck mortality (1 each): 101A1, 101A6, 102A2, 102A7. 102A2 appeared to be crushed and 102A7 had a chipped shell.
Geoduck HS mortality: 2 at 28°C
Small C. gigas HS mortality: 2 at 43°C, 8 at 44°C, and 6 at 45°C.

February 7, 2012
Secondary stressor and Multispecies OA
When I went down to the lab this morning the power had tripped to the 101 and 102 tanks again (it had been off for about 2 hours). I turned it back on. Heaters didn't seem to be working correctly in 101 tanks so I set them to autotune.
Took spec pH of all source water. Spec pH is corrected for temperature (13°C) using a TA of 2095 µmol/kg.

Tank	Durafet_pH	salinity	spec_pH
101A	8.01	29.6	8.012
101B	7.14	29.6	7.136
102A	8.00	29.6	7.926
102B	8.03	29.6	8.045
103A	7.60	29.6	7.588
103B	8.03	29.6	7.974
104A	7.73	29.6	7.726
104B	7.66	29.6	7.661

Calibrated probes for pH in tanks 102A and 103B.
Cleaned all tanks.
Geoduck mortality: 101A3 (1), 102A2 (2). Photo sent to CSF and shells stored in 95% EtOH.
Geoduck HS mortality: 1 at 29°C
Small C. gigas HS mortality: 0
HS'd small C. gigas (n=10) at 44 (blue zip tie) and 45°C (white bag) for 1 hour, with 10 minute warm up.
Made new m-cresol purple. Intercept = 0.023052 and slope = -0.0491.

Bioinformatics
Did RNA-Seq for both libraries (untrimmed) against consensus sequences from H. asi backbone (1176 references). See 1/9/12 for details on method.

February 6, 2012
Secondary stressor and Multispecies OA
Matt fixed the relay in the controller for 102B in the afternoon so it is now working correctly. However, in the evening the heater for 101B was staying on even though the temperature was 13.6°C (and rising). By 9:30 pm, the temp was at 13.9°C and I unplugged the heater for the night. Also, during the day the power kept on shorting out for tanks 101 and 102. When this happens, the controller for 102 for some reason automatically goes to manual mode and makes the pH creep up towards 8 (there were a lot of pH fluctuations for 102A and B today).
Did spec pH of source water and containers 3 and 4 for all treatments. Spec pH is corrected for temperature (13°C) using a TA of 2095 µmol/kg.

Tank	Durafet_pH	salinity	spec_pH
101A	7.98	29.5	7.984
101B	7.17	29.5	7.177
102A	7.98	29.5	7.885
102B	7.86	29.5	7.932
103A	7.61	29.4	7.695
103B	8.04	29.5	8.003
104A	7.73	29.4	7.742
104B	7.65	29.6	7.665

Geoduck mortality (1 each): 101A1, 102A4, 102A5, 102A7. Photo sent to CSF and shells saved in EtOH.
Geoduck HS mortality: 1 at 28°C (probably crushed), 4 at 29, and 2 at 30.
Small C. gigas HS mortality: 0.

February 5, 2012
Secondary stress and Multispecies OA
Cleaned all containers.
Fed animals in sea tables.
Geoduck mortality from HS: 0 dead from 22 and 25°C, 6 dead in 28, 5 dead in 29, 3 dead in 30, and 1 dead in 31.
small C. gigas mortality from HS: none
Geoduck mortality from OA: 101A4 (1), 101A6 (1, crushed), 101A7 (2), 102A2 (2, 1 crushed), 102A4 (1, lost the shell), 102A5 (1). Sent the photo to CSF and saved the shells in 95% EtOH.
I never heard back from Matt about fixing 102B so the temperature has remained steady around 11.8-11.9°C.
Calibrated Durafet probes for temperature.

February 4, 2012
Secondary stress and Multispecies OA
Took spec pH of all cooler water. Spec pH is corrected for temperature (13°C) using a TA of 2095 µmol/kg.

Tank	Durafet_pH	salinity	spec_pH
101A	7.98	29.5	7.963
101B	7.34	29.6	7.326
102A	7.66	29.6	7.598
102B	7.88	29.5	7.854
103A	7.58	29.6	7.593
103B	8.04	29.6	7.975
104A	7.73	29.6	7.770
104B	7.63	29.7	7.653

The temperature in 102B is about 11.9°C and the heater is not going on, meaning that there is something wrong with the relay. I'm not sure how to fix this, so I texted Matt about the problem with no response (it is a weekend).

February 3, 2012
Secondary stress and Multispecies OA
The water pressure was still bad in the 102 tanks this morning. I had removed the feeding coil and other parts so that it was just the one tube carrying water leading to the drippers (I put the feeding apparatus back together before the morning feeding but removed it soon after the pumps finished delivering food to maintain water flow to the tanks). Matt came and looked at it and realized that somehow the air had not been turned on enough after he had fixed the solenoid yesterday. He turned the air up and the water pressure problem was fixed. This means that from yesterday afternoon until this morning 102A and 102B were less aerated (had less O2) than the other treatment tanks.

Took spec pH of all cooler water and adjusted for temperature (13°C) using a TA of 2095 µmol/kg.

Tank	Durafet_pH	salinity	spec_pH
101A	8.08	29.8	8.061
101B	7.17	29.8	7.217
102A	7.68	29.7	7.609
102B	7.85	29.8	7.830
103A	7.61	29.9	7.597
103B	8.05	29.8	8.000
104A	7.72	29.9	7.751
104B	7.64	29.9	7.650

Mortality from HS 1/27/12:

• 101B: 2 dead, 0 left alive
• 102B: 0 dead, 1 alive
• 103A: 2 dead, 2 alive
• 103B: 1 dead, 1 alive
• 104A: 0 dead, 1 alive
• 104B: 2 dead, 2 alive

Sampled remaining live oysters: measured length, width, total weight, buoyant weight and sampled gills (flash froze in liquid N2 and stored at -80°C). Tube numbers are indicated in parentheses above after the number oysters alive.

Mortality from geoduck HS: 0 morts from 22, 25, 28, and 29°C. 5 morts at 30 °C and 1 mort at 31°C (1 geoduck is missing since there is only one left).
Mortality from small C. gigas HS: 0 mortalities at all temperatures.

Cleaned feeding lines going to tanks. Emptied all salt water and algae from the buckets and refilled ~1/3 with DI water. Used this same DI water to wipe down the sides of the bucket and flushed out the lines with this DI water/old algae mixture. Once buckets were empty of this liquid, refilled all the way with new DI water and flushed the lines. After the DI water was flushed through, Filled buckets to ~2/3 with salt water and ran through the lines. At the end, refilled the buckets with salt water and algae for the next feeding.

February 2, 2012
Secondary stress and Multispecies OA
Did total alkalinity and spec pH of all source water and container 7s. Poisoned 600 mL of water from container 8s for later analysis (with 75 µL HgCl2). Spec pH is corrected for temperature (13°C) using the given TA. The containers in 102A are a higher pH than the source water, which is unusual. I think this is because there was a lot of pH fluctuation in 102A today (see below) and there's a lag in what the containers experience relative to the source water during pH variation.

TANK	salinity	Durafet_pH	spec_pH	TA
101A	29.9	8.07	8.041	2093.75
101B	30	7.18	7.196	2095.42
102A	30	7.48	7.401	2094.81
102B	30.1	7.83	7.823	2095.16
103A	29.9	7.61	7.633	2094.84
103B	30	8.03	8.004	2094.14
104A	30	7.73	7.776	2094.52
104B	30.2	7.60	7.669	2095.96

The solenoid in tank 102 had to be replaced because it was not working properly (CO2 was not being dispensed appropriately to meet and maintain the set point pH). After it was replaced, I re-calibrated the probes using spec pH and ran accutune.
The am feeding seemed to have clogged some of the tubing in 102A. I replaced the part that was clogged and it is working fine now.
All the animals in the sea tables were fed.
Mortality from HS 1/27/12: 1 in 103A and 1 in 102B.
Geoduck mortality: 1 in 101A7 and 1 in 102A7.
Heat shocked geoduck at 29 and 30°C for 1 hour each. Mortality from yesterday's 'duck HS: 7 dead from 31°C and 1 dead from 28°C, although it looks to have died from being crushed. The three "live" geoduck from the 31 HS may not really be alive, but it was hard to tell if they were truly dead or just extremely lethargic from the stress.
Heat shocked 10 small Pacific oysters each at 40, 41, 42, and 43°C (10 minute warm up followed by 1 hour HS). Zip tie colors correspond to the following temperatures: pink = 40, purple = 41, yellow = 42, red = 43.
Calibrated Durafet probes for temperature.

February 1, 2012
Secondary stress and Multispecies OA
Took spec pH of source water for all coolers. Spec pH is corrected for temperature (13°C) at a TA of 2099 µmol/kg.

Tank	Durafet_pH	salinity	spec_pH
101A	8.07	29.9	8.056
101B	7.22	29.9	7.273
102A	7.79	30	7.759
102B	8.20	30	8.174
103A	7.61	29.9	7.645
103B	7.99	30	7.958
104A	7.74	29.9	7.767
104B	7.77	30	7.767

Calibrated temperature in all coolers.
Had to manually adjust CO2 flow in 102A and B and 104B this morning because they were not reaching the correct set points. The pH had settled by the afternoon so I ran accutune in 102A and B (don't think it is needed in 104B).
Cleaned all containers. Fed animals in sea tables.
Mortality from HS 1/27/12: 1 in 104B, 3 in 103A, 1 in 102B, 1 in 104A, 1 in 101B, 1 in 103B.

Today I helped to sample the oysters in Carolyn's experiment - took samples of mantle, gill, and the rest of the body for 1 C. gigas from each of her containers in 101A and 102A.
We are trying to find the lethal temperature for the geoduck seed. We are doing HS starting at 21°C at every 3 degrees. Today, HS was done at 21, 25, 28, and 31°C. The geoduck were not looking good after the 31°C - gaping, lethargic, siphons unresponsive to stimulation.

January 31, 2012
Secondary stress and Multispecies OA
Calibrated the new batch of acid from 1/30/12 with CRM 113. Ran samples that were taken previously and poisoned on 1/18 and 1/24/12.
Moose and Matt fixed an air flow problem to the system, but it made all the controllers go crazy. They ran accutune so everything should be better by this evening.
Mortality from HS 1/27/12: 1 each in 101B and 104A
Made new m-cresol purple.
Fed animals in sea table.
Geoduck mortalities (1 each): 101A1, 101A8, 102A8. Photo sent to CSF and shells preserved.
102B is having trouble getting up to its set point pH (7.87). I turned the CO2 flow down so there is less CO2 entering the Venturi.

Bioinformatics
downloaded all H. asinina ESTs (8,355) from GenBank and uploaded FASTA into CLC. This is the abalone with the greatest number of ESTs. Did de novo assembly of these ESTs: mismatch cost 2, insertion cost 3, deletion cost 3, length fraction 0.5, similarity 0.8, vote for conflict resolution, random non-specific matches, min contig length 200, map reads back to contigs.
This will be the Hasi backbone. Mapped both libraries back to the Hasi backbone. Made consensus sequences of Hasi assembly. Mapped both Pinto libraries back to Hasi backbone: mismatch cost 2, limit 8, fast ungapped alignment, vote conflict resolution, random non-specific matches.

January 30, 2012
Bioinformatics
Did some research on abalone phylogeny to find out if there is a closely related species to pinto abalone that may have a lot of data in GenBank to use as a backbone for assembly. In Coleman and Vacquier (2002), pinto abalone clusters the most closely to Haliotis sorenseni (white abalone) but is also in the same clade as H. rufescens (red abalone) and H. walallensis (flat abalone) based on intergenic spacer regions of ribosomal DNA (ITS) markers. In general, these markers showed very little variation within the North Pacific clade (shown below).

Number of sequences in NCBI:
H. sorenseni: no ESTs, 71 nucleotide
H. rufescens: 225 nucleotide, 358 ESTs
H. walallensis: 21 nucleotide, no ESTs
H. corrugata: 467 nucleotid, no ESTs
H. cracherodii: no ESTs, 87 nucleotide
H. fulgens: 136 nucleotide, no ESTs
Downloaded all H. rufescens ESTs from NCBI and uploaded FASTA file into CLC. Ran de novo assembly: mismatch cost 2, insertion cost 3, deletion cost 3, length fraction 0.5, similarity 0.8, conflict resolution vote, non-specific matches random, minimum contig length 200, map reads back to contigs. Also did a regular sequence assembly: did not trime seqs before assembly, min aligned read length 50, medium alignment stringency, vote for conflicts, create full contigs including trace data for output. Did the same assembly but this time created only consensus sequences. The de novo assembly resulted in 41 references; the first regular assembly resulted in 56 contigs.
Downloaded all EST and mRNA sequences for the species listed above.
Sequence assembly of H. rufescens ESTs and mRNA from NCBI: 50 min aligned read lengths, medium alignment stringency, vote for conflicts, create only consensus seqs.
Sequence assembly of all abalone ESTs and mRNA from NCBI: same parameters as above.
There are now 2 backbones: H. rufescens (Hruf backbone) and all North Pacific abalone species (allab backbone).
Mapped the untrimmed reads from sequencing (air and high CO2 together) back to the Hruf and allab backbones. Parameters: mismatch cost 2, limit 8, fast ungapped alignment, vote for conflict resolution, random non-specific matches. The mapped reads are saved within the directories that contain the contigs that make up the backbones in a file called "seqs mapped to ref".

Secondary stress and Multispecies OA
Ran Elene's TA samples. Cory made a new batch of acid and I tried to calibrate it with CRM 113 but couldn't get a consistent enough TA value so I will try again tomorrow.
Did spec pH on all source water. Spec pH is corrected for temperature (13°C) at a TA of 2099 µmol/kg. Matt fixed the controllers in tanks 104 so I calibrated the Durafets, reset the set points, and ran accutune.

Tank	Durafet_pH	salinity	spec_pH
101A	8.06	29.9	8.047
101B	7.28	29.9	7.336
102A	7.71	29.8	7.659
102B	7.87	29.8	7.873
103A	7.59	29.8	7.618
103B	8.00	30	7.964
104A	7.93	30	7.879
104B	7.82	30.1	7.778

Fed animals in sea tables.
Cleaned all containers and did mortality checks. In 101A4, there was a polychaete-type animal in the bag with the geoduck (I killed it). Geoduck mortality (1 each): 101A1, 101A8, 102A1, 102A4, 102A8. Photo was sent to CSF and shells were preserved.
Mortality from HS 1/27/12: None

January 29, 2012
Secondary stress and Mulispecies OA
Took spec pH of source water from all tanks. pH is corrected for temperature (13° ) with a TA of 2099 µmol/kg.

Tank	Durafet_pH	salinity	spec_pH
101A	8.05	29.8	8.042
101B	7.27	29.9	7.335
102A	7.70	29.9	7.658
102B	7.85	30	7.861
103A	7.60	29.9	7.593
103B	8.02	30	8.010
104A	7.78	29.9	7.795
104B	7.66	30.1	7.723

Geoduck mortality: 1 in 101A6, 1 in 102A4, and 1 in 102A7. Photo sent to CSF and shells preserved.
Mortality from HS 1/27/12: None
Animals in sea tables fed.
The stopcock between the water coming the containers and incoming water had been shut off and some point and not put back on so there was no new water circulating in the tanks. Food had gotten in from the peristaltic pumps. Opened the stopcock so water could start circulating.

January 28, 2012
Secondary stress and Multispecies OA
Cleaned tanks and did mortality checks. There were 3 geoduck mortalities: 1 in 102A1, 1 in 102A2, and 1 in 102A5. Photo was sent to CSF and shells were preserved. One of the clams in 102A3 was discovered to be an empty shell and was discarded (measurements = 12 x 16 mm). There is a slight chance that the oysters in 101A5 and 101A6 were switched and are now in the other container (the incorrect lid may have been put on the containers). One of the manila clams in 101A4 has a large crack in its shell but still appears to be alive.
The feeding lines were flushed with DI water. The buckets were filled with DI water and left to run into empty buckets until empty. The buckets were then filled halfway with salt water and that was run through the lines. The sides of the buckets were wiped down to remove residual algae. After cleaning, the buckets were refilled with salt water and 19 mL of algae and the animals were fed. During the cleaning process, the amount of liquid that comes out of the lines in 30 s was measured with a graduated cylinder for each tank. The amounts were pretty much the same between tanks (28 or 30 mL per 30 s). In the morning, ~1 mL of water from the drippers was taken during feeding for algal cell counts as described 1/27/12.

Tank	Numb_mL/30s
101A	30
101B	30
102A	28
102B	28
103A	30
103B	30
104A	28
104B	30

Spec pH was done of all source water. pH is corrected for temperature (13°C) with a TA of 2099 µmol/kg.

Tank	salinity	Durafet_pH	spec_pH
101A	30	8.02	8.007
101B	30	7.20	7.235
102A	30.1	7.63	7.602
102B	30.1	7.87	7.861
103A	30.1	7.62	7.584
103B	30.2	8.01	7.961
104A	30.1	7.76	7.757
104B	30.1	7.70	7.676

Mortalities from HS 1/27/12: 1 in 104B, 1 in 103B, and 2 in 104A.
Animals in sea tables fed.

January 27, 2012
Secondary stress and Multispecies OA
Algae counts: During the morning feeding, around 9:50 am, collected ~1 mL of water + algae directly from the drippers from each container #1. Counted the algae cells in a hemocytometer. I will repeat this for another container this evening or tomorrow morning. Also counted the cells from 1 mL of water taken directly from a feeding bucket. Samples were shaken before being loaded onto the hemocytometer. All counts are for the entire center square of the hemocytometer (i.e. 1 square millimeter). The counts were done in duplicate for each sample.

Tank	Algae_count1	Algae_count2
101A	3	4
101B	4	7
102A	2	3
102B	5	4
103A	15	7
103B	5	5
104A	1	4
104B	3	8

Counts for the bucket were 30 and 23.

Took spec pH of the source water from all treatments and from containers 7 and 8. Spec pH is corrected for temperature (13°C) and calculated using a TA of 2099 µmol/kg.

Tank	Durafet_pH	salinity	spec_pH
101A	8.02	29.9	7.977
101B	7.18	30	7.218
102A	7.62	30.1	7.612
102B	7.87	30	7.854
103A	7.60	30.1	7.608
103B	8.02	30.1	7.982
104A	7.76	30	7.746
104B	7.68	30.1	7.661

104B keeps on dipping down to a low pH (about 7.5) and then righting itself. In general, it fluctuates but stays within an acceptable range. Ran accutune to try to get it under better control.
Sea table animals fed.

Heat shock: Did LHT HS of oysters that were HS'd at SLT on 1/13/12. Oysters were warmed at 44°C for 10 minutes before HS at 44°C for 1 hour (monitored constantly by the Fluke temperature probe). Checked mortality at 6 pm (about 6 hours post-HS): 3 dead in 104A, 2 dead in 104B, 4 dead in 101B, 5 dead in 102B, and 4 dead in 103B.

2 geoduck mortalities: 1 in 101A7 and 1 in 102A7. Photo sent to CSF and shells preserved in 95% EtOH.

January 26, 2012
Secondary stress
Mortality from HS 1/19/12: 1 was dead from the 44°C treatment (100 % mortality). This is the new LHT.
Had to reset the relay in 104A.
Calibrated temperature for the Durafet probes.
All tanks were cleaned.
Algae counts: Collected 1 mL of water from the corner of each container #1 that is the farthest from the dripper during feeding (around 9:50 pm). Shook the tube and put 10 µL on a hemocytometer. The solution was too dilute to effectively count cells.
Fed all animals in sea tables.

Multispecies OA
replaced the durafet probe in tank 101A because it wasn't working. Also had to reset the relay because it wasn't communicating well with the heater. Calibrated the probe using spec pH.
Both tanks were cleaned.
Geoduck mortalities: 101A4 and 102A8 (1 in each).

Bioinformatics
The previous quality trimming that was done resulted in 0 sequences after trimming, meaning that none of the sequences were good enough to pass the filters. To test the quality of the sequences, I am going to map all the reads (untrimmed) back to reference sequences from GenBank.
Downloaded all pinto abalone (Haliotis kamtschatkana) nucleotide sequences from GenBank (43 sequences in all, these are the same as the ESTs in NCBI). Uploaded the FASTA file to CLC and from the high throughput sequencing tools, mapped the reads of each library back to the reference (the 43 sequences). Default parameters used and results saved to Pinto Ab file.
From DAVID results on 1/19/12, entered the GO Terms and p-values into revigo to get visualization. Exported the resulting table that goes with the figure and saved as REVIGO 012612.


January 25, 2012
Secondary stress
Mortality from HS 1/19/12: 2 were dead from the 44°C treatment and 2 were dead from the 43°C.
Power outage at midnight last night be most everything was righted by morning. Moose had to turn the CO2 scrubbers off for a while so there were some dips in the higher pH treatments.

Multispecies OA
3 geoduck were dead, 1 each in 101A1 101A7 and 101A8.

January 24, 2012
Secondary stress and Multispecies OA
Did TA for source water and from container 5 from all treatments. Took 600 mL sample from container 6, poisoned with 75µL HgCl2 and stored for later analysis. Also did spec pH of all source water and containers 5 and 6. Feeding occurred at 9:30 so I did not take any samples from containers between 9:30 and 11:00 (feeding ended at 10 and it takes about an hour for the water to turnover in the containers), although I continued to sample and analyze the source water. Matt cleaned all the containers in coolers 103A, 103B, 104A, and 104B and I cleaned all the 101s and 102s.
All animals in the sea table were fed.
Mortality from HS 1/19/12: None

Multispecies OA
Today was Carolyn's sampling day. She and Dave were not able to finish sampling before they had to catch the ferry so I sampled C. gigas from containers 101A7 and 8 and 102A2-8: length, width, total weight, buoyant weight, shell weight, gill, mantle, and rest of body (the last three were flash frozen in liquid N2 and stored at -80°C). Also, I took 1 geoduck from each container, took a picture of all 8 in each treatment, and then put 8 into a tube (1 tube for each treatment) and flash froze for transcriptomics.


January 23, 2012
Secondary stress and Multispecies OA
Texted Matt about broken heater but have not heard back from him. Looked at other heaters in other tanks, but they cannot simply be unplugged and swapped out so have to wait for Matt...
Mortality from HS 1/19/12: None

Spec pH was done for all source water and is corrected for temperature (13°C) at TA of 2076 µmol/kg.

Tank	salinity	Durafet_pH	Spec_pH
101A	29.4	8.04	7.997
101B	29.8	7.10	7.158
102A	29.7	7.64	7.637
102B	29.8	7.87	7.846
103A	29.8	7.58	7.573
103B	29.9	8.03	7.993
104A	29.7	7.72	7.710
104B	29.8	7.68	7.587

January 22, 2012
Secondary stress and Multispecies OA
All containers were cleaned. One geoduck was dead in each of 101A3 and 102A6 (photo emailed to CSF and shells stored in EtOH).
Mortality from HS 1/19/12: 2 oysters were dead from the 45°C treatment and 3 were dead from the 44°C treatment.
The heater in 101A seems to be broken and the temperature is around 11.5°C. I told Moose about it but he had no suggestions. Matt is out of town still but will get in touch with him tomorrow.

January 20, 2012
Secondary stress
Sampled gill tissue from 96 oysters that were heat shocked last Friday (1/13/12) at either 43°C for one hour (LHT) or 38°C for 1 hour (SLT) followed immediately by LHT. Each oyster was shucked and the anterior portion of all lamellae was sampled and flash frozen in liquid N2. The samples were stored at -80°C. Oysters were measured to match them to the measurements taken pre-HS last Friday and shell weight was recorded.
Spec pH was taken of all source water and from containers 3 and 4 in each treatment. In the table, spec pH is corrected for temperature (13°C) using a TA of 2076 µmol/kg.
All containers were cleaned.

Tank	Durafet_pH	Spec_pH	Salinity
101A	8.04	8.012	29.7
101B	7.21	7.247	29.8
102A	7.71	7.713	29.9
102B	7.86	7.870	29.6
103A	7.61	7.637	29.8
103B	8.06	8.026	29.8
104A	7.73	7.704	30
104B	7.64	7.653	29.9

The dripper in 104B3 was not working (probably clogged from algae). I replaced it with a new dripper, which worked fine.
Mortality from HS 1/19/12: 5 oysters were dead from the 45°C treatment and 2 were dead from the 44°C treatment. Heat shocked oysters, along with all other animals in the sea tables, were fed.

Multispecies OA
2 geoduck were dead in 101A8 (1 appeared to be dead from a crushed shell) and 1 was dead in 102A8. Geoduck were photographed and the shells were stored in 95% EtOH. In 101A6, 1 manila clam was discovered to be an empty shell so the sample size is only 9 for this container. The clam's measurements are 13x17 mm. One of the Olympia oysters from 102A1 fell into the 102A2 container. The oysters in 102A2 all need to be measured and the correct oyster returned to 102A1.
As described for secondary stress, spec pH was taken of the source water and containers 3 and 4. All containers were clean and animals examined for mortality.

January 19, 2012
Multispecies OA
Tank 102A was still at a high pH (7.78) this morning. I set the control to manual and opened the CO2 flow valve to let more CO2 into the water (I think that it wasn't open enough to allow for that much lowering of the pH given that the incoming water is about 8.14). Once the pH got down to about 7.70 I turned it back to auto. At pH of 7.65 I lowered the CO2 flow meter back down and set accutune.
Took spec pH of source water from both coolers (see table below).
Set up feeding system. Used Matt's spreadsheet to calculate how much Shellfish Diet 1800 to dilute in 15,000 mL of seawater (19 mL). The animals will be fed twice a day with the pumps on for 30 minutes each time. The leftmost bucket sources the food for tanks 101A and 102A; the middle bucket is for 101B, 102B, and 103A; and the rightmost bucket is for 103B, 104A and 104B. Cycle time is set for 12 hours and % on is 6%.
2 geoduck were dead in container 101A4 (one of them seemed to have a crushed shell). One geoduck was dead in 102A4 and it's shell was so brittle that it crushed when I touched it. The geoduck shells were preserved in 95% EtOH and a photograph of them was sent to CSF.

Secondary stress
Tank 104B had crashed to a pH of <7 so I emptied most of the water out to refill. The pH should be about 7.67. I also noticed that when the controller is on auto, there's some sort of offset and its setpoint pH is actually about 0.2 units below what is entered. I raised the setpoint to about 7.8 and I'll ask Matt about this when he is back next week.
Took spec pH of source water from all coolers. Spec pH is corrected for temperature (13°C) and based on a TA of 2076 µmol/kg. Durafet probes were calibrated for temperature as needed. See above for feeding information.

Tank	Durafet_Temp	Fluke_Temp	Durafet_pH	Spec_pH	Salinity
101A	12.6	12.8	8.06	8.022	29.6
101B	11.5	11.7	7.22	7.231	29.5
102A	12.1	12.7	7.67	7.694	29.6
102B	12.1	12.8	7.86	7.846	29.7
103A	12.9	13.5	7.58	7.589	29.9
103B	12.8	13.2	8.05	8.021	29.7
104A	12.6	13.3	7.71	7.729	29.6
104B	12.7	13.3	7.53	7.530	29.5

Re-establishing LHT: heat shock of 8 oysters per temperature at 42 (purple bag), 43 (white zip tie), 44 (pink zip tie), and 45°C (purple zip tie). The oysters are given a 10 minute warm-up and then HS'd for 1 hour. It seems that there was a problem with thermometer accuracy last time and that the thermometer used for the LHT read 43°C when the temp was really only 40.6°C. The Fluke digital thermometer will be used for all future HS. The oysters that were supposed to be HS'd tomorrow (7 days post SLT) will instead be HS'd next week after the LHT has been determined with the Fluke.

Bioinformatics
Removed spaces from the first column of the RNA-Seq file exported from Galaxy so that the contig indicators match the blastall file (e.g. "Consensusfromcontig1"). Saved file as tab delimited and uploaded into Galaxy. Got rid of header information in blastall file and separated columns by "|". Made sure there were no gaps in the data in this file or in the blastall file. Contig number is now in the first column for both datasets.
Under "Join, Subtract, and Group" chose "Join 2 datasets". For job 12, did not keep lines that didn't match and did not fill empty columns. For job 13, kept unmatching and incomplete lines and filled empty columns. Continued analysis with job 13.
Joined resulting table from job 13 with uniprot swissprot IDs (22nd column of the former and 1st column of the latter). This is job 14. Joined this resulting table with swissprot associations based on swissprot ID (column 22 with column 2): job 15.
Joined job 15 table with GO to GOslim table based on GO ID (column 42 with column 1): job 16. Exported this table to Excel. Removed redundant and unnecessary columns and saved file as "Galaxy Job 16 joined tables 011912". Sorted file based on e-value and removed all e-values less than 1e-5. Filtered the file again based on Fold change and deleted all rows with fold change between -2 and 2 (i.e. fold change less than or equal to 2). Saved this file as Galaxy Job 16 joined tabled 011912 fold change. Deleted all information except for column of SPIDs and saved as SPIDs for DAVID 011912. Uploaded to DAVID as gene list.
Edited the original SwissProt ID table uploaded into Galaxy by doing advanced filter in Excel and copying just the unique values into new columns to make a file of unique SPIDs (file is saved with this name). This file contains just one column of SPIDs. Uploaded as the background file into the DAVID Gene Functional Classification Tool indicating that it was Uniprot Accession numbers.
This analysis didn't yield any results (0 clusters, whatever that means) so maybe this isn't the tool that I want. Am going to try Functional Annotation Clustering. Chose Gene Ontology from the list of options.

Watched SR's video on DAVID and I was using the wrong background. Went back to the original exported Galaxy file (job 16) and deleted all columns except for SPID. I then copied unique values only into a new column and saved these as DAVID background 011912. I uploaded this file into DAVID. I then uploaded the SPIDs for DAVID 011912 as my gene list and did functional annotation clustering. Chose Gene Ontology and looked at chart for GOTERM_BP_FAT (see screen shot below). Downloaded the file as DAVID GO table 011912.


January 18, 2012
Secondary stress and Multispecies OA
Ran total alkalinity for all source water and for container 1 from each treatment (8 coolers). Took alkalinity sample (600 mL) from container 2 and poisoned with 75 µL HgCl2 for later analysis. The alkalinity has dropped about 20 units to approximately 2076 µmol/kg seawater. I recalculated setpoints for the coolers based on this new TA and on the desired pCO2 levels and the pH does not change considerably for any of the treatments (i.e. this 20 unit change in TA results in changes to pH in the thousandth place). Took 2 replicate samples of source water from 101A, 101B, and 102A in beer bottles to send off to test 2 companies that sell titrators.
Did spec pH of all source water and from containers 1 and 2 from all 8 coolers. Spec pH of source water corroborated what the Durafet pH probes read. pH from containers 1 and 2 was not more than 0.05 units different from source water pH.
Since the weather has gotten colder, the water in the treatments has been closer to 12°C than 13°C so I turned the chillers up from 11 to 12°C so that the heaters have less work to do.
The pH in 102A will not go down to 7.67. I tried to set it below the setpoint, but it still hovers around 7.78-7.80 (the probe is properly calibrated). I ran accutune overnight to try and fix the problem.
Fed all animals and cleaned containers. Did mortality checks. 3 geoduck were dead in the higher pCO2 treatment (102A): 1 each from containers 1, 3, and 4. Photographed the geoduck to send to CSF and preserved the shells in 95% EtOH for later SEM analysis.
There were no mortalities of HS'd oysters. Tomorrow I will do another HS with n = 8 oysters per temperature at 42, 43, 44, and 45°C.

January 17, 2012
Secondary stress
Made new m-cresol purple. Took spec pH of all coolers and did 2nd dye addition to do a correction.
The slope of the new dye correction curve is-0.03482 and the intercept is 0.018166. Spec pH is corrected for temperature based on a TA of 2095 µmol/kg.

Tank	salinity	Durafet_pH	Spec_pH
101A	29.5	8.03	8.011
101B	29.6	7.27	7.294
102A	29.8	7.69	7.789
102B	29.6	7.86	7.859
103A	29.6	7.57	7.586
103B	29.8	8.02	8.002
104A	29.5	7.74	7.714
104B	29.4	7.66	7.673

The probe for 102A was calibrated since the actual pH was 0.1 unit higher than the perceived pH.

Animals were fed. No mortalities from HS.

Matt showed me the set up for the automated feeding and I think I will work on that Thursday. The algae delivered to the containers ends up being at 5% concentration of the algae in the source buckets. The buckets are marked with a fill line at 20,000 mL for calculating how much algae to add to a bucket of seawater.

Multispecies OA
Took spec pH of both coolers (see above table).
Animals were fed.

January 16, 2012
Secondary stress
Ran total alkalinity samples that were taken on 1/7/12 and 1/10/12. Also ran 3 of the Mukilteo samples that Carolyn brought up. Did spec pH on the source water for all 8 coolers. NB: salinity was not taken at the exact time of spec pH, but was taken about 1 hour later. Spec pH has been corrected for temperature based on a TA of 2095 µmol/kg.

Tanks	salinity	spec_pH
103A	29.4	7.638
103B	29.5	8.014
104A	29.5	7.731
104B	29.6	7.664
101A	28.9	8.037
101B	29.1	7.401
102A	29.4	7.780
102B	29.4	7.853

Fed oysters and cleaned containers after feeding.
There was no mortality in the HS'd oysters.
Cleaned spec pH cuvettes overnight.

Multispecies OA
Throughout the day adjusted the pH in cooler 102A to about 7.67 (pCO2 of 1000 ppm).
Fed bivalves and cleaned containers. Checked all animals for mortality. 4 geoduck were dead, 1 in each of containers 101A1, 101A3, 102A3, and 102A6. Photographed the dead animals with a scale for size.
NB: When cleaning these containers make sure that none of the geoduck have fallen out of their bag to the bottom of the container.

January 15, 2012
Secondary stress
There is no mortality from HS.
Oysters were fed 120,000 cells per mL (water circulation turned off for 1 hour).

Multispecies OA
Animals were fed 120,000 cells per mL.

January 14, 2012
Secondary stress
Fixed samples were moved from Davidson's fixative into jars of 70% EtOH.
There was no mortality from HS.
The oysters for the 1 month OA exposure were measured, weighed individually for buoyant weight, and weighed for total mass of all the animals in a container together. 6 oysters were put in each container at pCO2 of 400, 600, 800, 1000, 1200, or 1400.

Multispecies OA
Animals were measured before being put into one of 8 containers in each of 2 coolers. The coolers are both currently set at a pH of >8.0 (pCO2 ~400 ppm).
Pacific oysters - 25 animals were measured lengthwise and weighed individually for buoyant weight to get an average. There are 10 C. gigas in each container and these 10 animals were massed for buoyant weight together before being placed in pillow bags in the container.
Geoduck - There are 20 geoduck in soft mesh bags in each of the containers. Before being placed in the containers the geoduck (in groups of 10) were photographed for measurements and weighed for total weight.
Olympia oysters - There are 3-4 Olys per container. Before being placed loose in the containers Olys were measured (length and width) and buoyant weight was taken. Epibionts were scraped off. Of the three containers that have only 3 Olys, 2 of them have Olys with smaller Olys settled on them and 1 has a particularly large oyster.

January 13, 2012
Secondary stress
Today was the end of the 1 week OA exposure experiment and the big sampling/heat shock day. I started at 7 am and finished at 11:30 pm. 4 different heat shock (HS) regimes were performed on the oysters and for each one 1 oyster from each container per treatment (n = 8 per treatment) were used. HS1 was 38°C for 1 hour and in one week (1/20) these oysters will be HS'd at 43°C for 1 hour and then monitored for mortality. HS2 was 38°C for 1 hour followed immediately by shucking and sampling of gill tissue for NGS. HS3 was 43°C for 1 hour and monitoring throughout the week for mortality. HS4 was 38°C for 1 hour followed immediately by 43°C for 1 hour and monitoring for mortality. After HS, all oysters were put in labeled mesh bags in a sea table where they will remain throughout monitoring.
Sampling was done on all other oysters. Oysters were measured (length and width) and weighed before sampling. Oysters were shucked and separate gill tissue samples were taken for gene and protein expression and immediately flash frozen in liquid nitrogen. A section was taken for histology that included the DG and gill as well as a separate section of part of the adductor muscle. These sections were fixed for 24 hours in invertebrate Davidson's fixative.

January 12, 2012
Bioinformatics
Exported RNA-Seq files from CLC into "Emma's data" folder. Also began new RNA-Seq on de novo assembly 2.
Uploaded blastall results into Galaxy. Tried to upload RNA-Seq files, but they wouldn't upload.
Ran experiment on RNA-Seq files to do comparison of gene up- and down-regulation and exported as csv files. This file was uploaded successfully into Galaxy.

Secondary stress
Fed all animals and cleaned containers in acclimation coolers.

January 11, 2012
Secondary stress
Took spec pH of all experimental tanks and calibrated probes for temperature and pH. pH is corrected for temperature.

Tank	salinity	Durafet_T	Fluke_T	Durafet_pH	spec_pH
101B	29.9	13.1	13.1	7.31	7.366
102B	29.9	12.9	13	7.86	7.864
103A	29.9	12.9	13	7.55	7.60
103B	30.1	12.9	12.9	8.03	8.013
104A	30.1	12.9	13.1	7.78	7.750
104B	30.1	13.2	13.2	7.63	7.634

Fed all the oysters and cleaned experimental tanks.

Multispecies OA
Received manila clams and put in sea table. Fed all animals.

January 10, 2012
Secondary stress
Did full TA and spec pH for all experimental coolers. Ran titrations for all source water and samples from all containers number 3. Took and poisoned samples for all containers number 4. Did spec pH on samples from all source water and all containers 3 and 4. Spec pH was calculated based on the TA that was found for the source water in each cooler. The TA for 104B is a little off becuase it was run with a salinity of 29.7 rather than 30.2. Spec pH has been corrected for temperature.

Tank	salinity	Durafet_pH	spec_pH	TA
101B	29.4	7.26	7.274	2091.87
102B	29.9	7.86	7.857	2092.27
103A	29.6	7.54	7.552	2097.14
103B	29.7	8.03	7.968	2093.44
104A	29.7	7.76	7.664	2094.94
104B	30.2	7.68	7.596	2092.69

Did spec pH on source water for acclimation coolers. Calibrated the Durafet probes for temperature. Spec pH has been corrected for temperature based on a TA of 2095 µmol/kg.

Tank	salinity	Durafet_T	Fluke_T	Durafet_pH	spec_pH
105A	29.5	12.9	12.8	7.96	7.913
105B	29.7	13.6	13.5	7.97	7.958
106A	29.9	12.9	12.8	7.94	7.926
106B	30	13.1	13	7.92	7.841
102A	30	12.7	12.5	7.94	7.917
101A	30	12.9	12.8	7.97	8.092

All oysters were fed and acclimation tanks were cleaned. Oysters were redistributed randomly between the acclimation tanks at the end of cleaning.

Multispecies OA
Carolyn brought up mussels, geoduck, olympia oysters, and pacific oysters for a multispecies OA experiment. The Pacifics are small, about the size of a thumbnail. The Olys are larger, about 1 inch long. The mussels look like they are just post-larval and the geoduck are also small seed, but larger than the mussels. Manila clams are arriving tomorrow. All animals were put in sea tables. All animals were fed shellfish diet 1800.

January 9, 2012
Secondary stress
Made new m-cresol purple (see 1/2/12). Took spec pH from all experimental coolers and used them to do the dye correction. The intercept for the dye correction is 0.013592 and the slope is -0.03138. Calculated the temperature-corrected pH from spec pH at 25°C with an assumed TA of 2095 µmol/kg.

Tank	salinity	Durafet_pH	spec_pH
101B	29.7	7.29	7.265
102B	29.8	7.86	7.867
103A	29.9	7.49	7.428
103B	29.8	7.93	7.894
104A	29.9	7.70	7.729
204B	30	7.62	7.650

Changed set points on a couple of the coolers that are consistently below their set points.

Fed all the oysters and cleaned the containers for the experimental oysters.

Bioinformatics
Started a new de novo assembly (Emma de novo 2) on pinto ab OA data. The parameters for the new de novo are all default, except the mismatch costs were changed to 3 and the min contig length was decreased to 150.

Began RNA-Seq analysis to find differentially expressed genes between data sets. The consensus sequences from the de novo assembly were used as a reference backbone (8911 sequences). The analysis was done on a reference without annotations and with default assembly settings, except the unmapped sequences box was unchecked. RNA-Seq was done for both data sets.
Detailed instructions:

• Open file of consensus sequences in CLC so you can view it and select all sequences by clicking on the first one, scrollingn down, hold shift and click on last one
• Click "open consensus" at the bottom of the window
• Resave the file into a folder in your CLC directory - this file will be your reference for RNA-Seq
• Right click on your raw data file and select toolbox -> CLCserver -> RNAseq analysis
• Use default options on the RNA-Seq with the following changes: 1) reference without annotations, 2) uncheck unmapped sequences
• Repeat RNA-seq with your second sequence file
• To do a comparison of your RNA-seq for your datasets, go to high throughput sequencing in your toolbox and select "Run an experiment". Keep your default settings

Quality trimmed raw data, discarding lengths below 20 and saving the trimmed sequences in the trimmed sequence folder.

Annotated the consensus sequences using the wetgenes INQuiry portal. Used the blastall tool with the following parameters: blastx against swissprot database, short description and number of alignments changed from 500 and 250 (respectively) to 1, tabular output.

January 8, 2012
Secondary stress
Calibrated Durafet probes in acclimation tanks for temperature and pH as described 1/7/12. Saw that 103B2 was not attached to its dripper so no clean water was circulating through (dripper was reattached).

Tank	salinity	Durafet_pH	Durafet_Temp	Fluke_Temp	spec_pH
105A	29.9	7.97	12.9	13.4	7.908
105B	29.9	7.96	13.5	13.9	7.867
106A	30	7.95	11.6	12.3	7.762
106B	30	8.06	11.4	12.1	7.707
102A	30	7.97	13	12.8	7.939
101A	30	7.96	13	13	7.947

Checked pH, salinity, and temperature of Durafet probes for experimental tanks. Probes were calibrated when the temperature or pH were off.

Tank	salinity	Durafet_pH	Durafet_Temp	Fluke_Temp	spec_pH
101B	29.7	7.27	13.1	12.9	7.290
102B	29.8	7.86	13.1	13.1	7.860
103A	29.9	7.52	13	12.9	7.508
103B	29.9	7.95	13	12.8	7.924
104A	30	7.71	13	13.1	7.729
104B	30	7.65	13.1	13.1	7.687

Emptied some of the water from tank 101B to try to get pH up.

In the evening did mortality checks and fed all the oysters. Cleaned all the containers in the acclimation coolers. The process is slightly different from the experimental coolers: all oysters are removed and put in a common bucket while the containers are cleaned. After all containers are clean, oysters are re-assorted into containers randomly.

January 7, 2012
Secondary stress
For the most part, the pH seems to be stable at about the right value for all of the coolers except for 101B. Continue to empty water from this cooler and refill with new (high pH) water to counterbalance the low pH of about 7.

Did chemistry for all the coolers. Took spec pH and TA samples from the source water and from containers 1 and 2 (see diagram below for container numbers). The pH in the containers was not more than 0.05 pH units less than the source water pH. Used the spec pH values to calibrate the Durafet probes and also calibrated probes for temperature using the Fluke probe (see table). All probes were pretty accurate, except for 103A, which is the control treatment. The probe read a pH of about 8, but it was actually around 7. I verified this with a second spec pH. I calibrated the probe, drained the water and it quickly righted itself but the oysters were exposed to low pH water for about 36 hours. All the treatments equilibrated to the new pH much better after the probes had been calibrated. I also ran TA titrations for the source water and for one of the containers for all the treatments. In general, the source water TA was around 2095 µmol/kg seawater and the container TA was about 10-20 units lower. TA samples were taken for all container 2s by rinsing out sample jars with 60 mL of seawater, filling them with 300 mL of seawater from the container and poisoning with 75 µL HgCl2. I ran CRMs at the beginning, middle, and end of the titrations. I also got TA values for Liza's 4 samples from her pinto abalone experiment done 9/29/11.

I also calibrated the Durafet monitoring the incoming water using 2 spec pH samples. The probe read pH 8.1 and, assuming a salinity of 29.7 and temperature of 10°C, the actual pH is about 8.1.

In the evening, I fed all the oysters (experimental and acclimation) by diluting 19 mL of shellfish diet in 941 mL of ambient seawater and pipetting 9 mL of this mixture into each of the containers (flow turned off). I let the oysters sit for about an hour so that they could feed. After an hour, I turned the flow back on and cleaned all the experimental containers. It takes about 15 minutes to clean all 8 containers in each treatment and I do 2 at a time, so the oysters are only out of water for about 2 minutes. I put all the oysters back in the container that I had taken them from.

Tank	salinity	Durafet_pH	Durafet_Temp	Fluke_Temp	spec_pH
104A	29.5	7.70	13	12.4	7.56
104B	29.7	7.59	13	12.4	7.49
102B	30.1	7.86	13	12.4	7.67
103B	30	7.91	12.8	13	6.84
103A_2pm	29.9		12.9	13.2
103A_4pm	29.7	7.52			7.31
101B	30	7.08	13	12.8	7.03

TA samples for 103A were taken at 2 pm and spec pH samples were taken at 4 pm. spec pH in the table has been corrected for temperature (13°C).



January 6, 2012
Secondary stress
Set the pH set points at 7 am. Some of the oysters got switched to different tanks if I was having trouble with the controlers. The tanks and their set points are in the table below. Changed the PID tune parameters to the numbers from cooler 103B since it has been the most consistent in keeping the correct pH: Prop bank 0.911, Rate 1.446, Reset 0.173. When pH gets too low (>0.2 units below the set point), I drain most of the water from the tank and refill it with fresh water. Accutune is run once the pH has reached a level close to the set point.

Tank	pCO2(ppm)	pHsetpoint
101B	1400	7.533
102B	600	7.876
104A	800	7.762
104B	1000	7.671
103A	1200	7.597
103B	400	8.034

Filled up 6 other coolers to begin system acclimation of the other oysters that have been held in the sea tables. Set the temperature at 13°C and the pH at 8.
Continued to monitor and adjust coolers throughout the day to get the pH to stabilize at the correct value. Having trouble with coolers 104A and B and 101B and a little bit with 103A. 101B is especially troublesome because I'm having trouble getting it to stay above a pH of 7, let alone get to 7.53.
In the evening, fed the oysters in each of the experimental tanks and the oysters in the sea tables. After feeding, moved oysters from see tables into containers in acclimation coolers (6 coolers, 8 3-L containers per cooler). There are 8 oysters per container. pH remains steady at about 8 in all. There were no mortalities.

January 5, 2012
Secondary stress and Total Alkalinity
Cleaned out tanks 103A and 103B as described 1/1/12.
Calibrated Durafet pH probe in tank 101A using spec pH.
Ran total alkalinity for 2 more beer bottle samples. Began by running replicate junk samples until the TA values were within 2 units of each other (this took 3 samples). Ran a CRM (batch 113 bottle 0780) but the first run did not yield a TA close enough to the value: the experimental value was 2219.14 and it needs to be 2224.65. Ran another CRM, which was also not the right number. Ran 4 junk samples to check precision of titrator and got the same number for each sample. Ran a CRM which gave a TA of 2220.5. Decided to run allt he beer bottle samples for 1/5/12 - the data can be found in the spreadsheet chemistry 010512.

Calculated set points for each of the tanks based on a presumed TA of 2100 µmol/kg and a temperature of 13°C.

Tank	pCO2(ppm)	pHsetpoint
101A	800	7.762
101B	400	8.034
102A	1400	7.533
102B	600	7.876
104A	1200	7.597
104B	1000	7.671

Moose turned on the vaccuum pump this morning to remove the CO2 from the incoming water. I turned on the air going into the tanks. Later in the evening (around 6 pm), I turned on the CO2 going into the tanks and put the set points at pH 8. I monitored the pH until 11 pm and all tanks seemed pretty stable.
Fed the oysters as previously described and cleaned the containers. There was one dead oyster in 101B and I replaced it with an oyster from the sea table.

Bioinformatics
Pinto abalone larvae NGS data were uploaded into CLC genomics workbench. There are 2 experimental groups: ambient (control) and high pCO2. Ran 2 different de novo assemblies on them.
I. default parameters: mismatch cost 2; limit 8; fast ungapped alignment; vote ACGT; non-specific matches random; min contig length 200; map reads back to contigs; result handling open; make log
II. same parameters except turned global alignment on

January 4, 2012
Secondary stress
Checked pH of source water and 5 containers to see if pH had changed over night after the water change. There was an approximate 0.05 pH unit change between all the containers and the source water.
Calibrated all the Durafet probes for temperature and pH using the Fluke probe and spec pH, respectively.
Fed all the oysters as previously described.

January 3, 2012
Secondary stress
Calibrated the acid for the total alkalinity titrator by running 3 CRMs within 1 unit of each other (they were all less than 1 unit different) and using those numbers to back calculate the acid concentration since the CRM TA is known.
Did a dye correction for the spec pH using 2 samples from 2 difference coolers and then 2 other samples to which either NaOH or HCl was added. The slope for this dye batch (1/2/12) is -0.02313 an the intercept is 0.009991.
Measured pH from the source water and 1 container each from 101A and 104B (see table below). pH values are corrected for dye addition, but not for temperature at which they were taken. Since there seems to be a difference between source and container water, took spec pH of 102B source water and 5 containers (table below). Also did TA titrations of 102B source water and 2 containers.

Sample	TA(µmol/kg)	pH	pHdifferencefromsource
101A source (s)		7.53
101A container(c)		7.49	0.036
104B s		7.51
104B c		7.39	0.12
102B s	2111.97	7.53
102B c1	2068.51	7.45	0.081
102B c2		7.46	0.065
102B c3		7.46	0.066
102B c4		7.47	0.055
102B c5	2075.44	7.47	0.057

Note that for 104B, there may have been a bubble in the path of the spec which may have skewed the results. In general, the difference between container and source water pH is about 0.06 pH units. The TA is about 40 units different, or about 2%. Tomorrow morning I will repeat this experiment since all the containers were cleaned tonight.

Fed all the oysters as described 1/2/12. Cleaned all the tanks as described 1/1/12.

January 2, 2012
Secondary stress
Cooler 101 B was below its set point and the heater was never going on and 101A was above its set point and the heater wasn't going off (only a couple of degrees in each direction). The autotune function was not on for either heater so I turned it on.
Checked ammonia levels in one container from 101B, 101A, and 102A and from one of the sea tables. Ammonia was very low in all. Also took pH from the source water and one container from 102B and 104A and from the sea table (see table below). I have not done the dye correction for the new m-cresol purple yet, so the pH have not been properly adjusted. Additionally, the cuvettes were probably not very clean because many small bubbles formed inside and could not be dislodged so the pH values are probably not completely accurate. M-cresol purple was made by dissolving 0.016 g of MCP in 20 mL of milliQ water (2 mmol/L) and adding dilute NaOH until the pH = 7.9. pH values are calculated in CO2sys assuming 2100 µmol/kg TA and adjusted temperature of 13°C except for the sea table where the temperature is assumed to be 10°C. Salinity was measured in the source water in each container and used to correct pH.

Sample	Salinity	MeasuredpH	CorrectedpH
102Bsource	29.7	7.51	7.67
102Bcontainer	29.7	7.43	7.58
104Asource	29.9	7.50	7.67
104Acontainer	29.9	7.40	7.55
sea table	29.5	7.44	7.63

Due to the possible inaccuracies in these pH measurements (dirty cuvettes and incorrect dye correction values), these values are not completely reliable. I cleaned the cuvettes with cuvette detergent (2 drops in a cuvette filled with DI water, shaken well, left to sit over night) and will take the pH again tomorrow.

Fed the oysters in the containers and sea tables by turning off flow and giving them ~120,000 cells per mL of shellfish diet. Put 19 mL of shellfish diet in 941 mL of seawater and gave 9 mL to the container oysters and 255 mL to the sea table oysters (estimated sea table dimensions used to calculate volume: 3' x 2' x 0.5').

January 1, 2012
Secondary stress
Oysters were fed as described 12/31/11 except they were fed ~120,000 cells per mL
Emptied all coolers and cleaned out by removing debris, wiping down with Vortex, rinsing and wiping down with freshwater and then salt water. Coolers were then refilled with salt water. Only 6 oysters were replaced in each of the containers (which had been cleaned by rinsing with fresh and then salt water) and only 6 coolers were used (8 reps of 6 per cooler). These will be the oysters used in the 1 week OA exposure. The remaining oysters were divided between 2 sea tables.

December 31, 2011
Secondary stress
Fed oysters in their containers about 60,000 cells of algae (Shellfish Diet 1800) per mL by diluting the SD in seawater and turning on flow in containers for ~30 minutes. Checked ammonia levels of a few containers and all were low.

December 30, 2011
Secondary stress
Brought oysters up to Friday Harbor. Changed filters with Michelle (put in new bag filters and clean 0.2 µm filters). Turned on water to coolers and let run through to rinse out lines for > 1 hour. Put ~110 oysters in each of 6 coolers and set temperature to 13°C. Moose later told me that having them in the coolers would contaminate the water for the remainder of the experiment, so put oysters in microcosm containers (3.5 L). 10 oysters were placed in each containers and 8 containers were put in each of 8 coolers. Green drippers (57.5 mL/ min) were used for flow of water into containers.

December 29, 2011
Secondary Stress
2 am: collected ~650 oysters (same group as used for most recent heat stress experiment) in Oyster Bay at low tide. Put oysters in mesh bags in a cooler, covered with towels and put a few ice packs on top of the towels. The oysters remained in the cooler (ice packs were replaced when thawed) until the afternoon of 12/30.



September 29, 2011
Secondary Stress Trial
Bivalves in large tank were fed at 8:15 am (see spreadsheet).
The feeding jars for the pH trial were fed at 9:15, 20 mL into each jar.

September 28, 2011
Secondary Stress Trial
Bivalves in large tank were fed at 9:15 am (see spreadsheet).
In the morning, all jars were sampled for spec pH, salinity, temperature, and ammonia (for jars containing animals and 1 control). In general, pH dropped to about 6.9 in all the oyster jars regardless of starting pH, stayed consistent in the non-animal controls, stayed consistent in the clam jars with 5 clams, and dropped a little (~0.2 units) in the clam jars with 10 clams. After sampling for pH, all animals were fed 40 mL of algae.
In the afternoon, 1 jar from each replicate was sampled for spec pH and total alkalinity. Duplicate alkalinity samples were taken for time series of beer bottles and for verification of the Forestry spec method. All samples were poisoned with ~70 µL HgCl2. After sampling, water was changed in all the jars. The ambient water was at pH 8 so we added 0.4% of high CO2 water to 4.75 L of ambient to get the low pH treatment.
Dave will feed all the animals in the evening. Only 1 jar from each replicate will be fed for the next 24 hours to see if feeding causes changes in pH (jars 1 are the fed jars).
The new treatment water is pH 8.03 for low CO2 and 7.77 for high CO2.
For detailed pH, see water chemistry spreadsheet.

September 27, 2011
Secondary Stress Trial
Bivalves were fed at 8:20 am (see spreadsheet).
Took 2 cuvettes full of water from each trash can (low and high CO2) and added 70 µL of 0.1 N NaOH or HCl to low and high, respectively. The low CO2 Mukilteo water is 7.7 and the high is not calculable because it is so high.
Mixed 50/50, 25/75, and 10/90 high/low CO2 water and took pH. The 10/90 mixture was at pH of ~4.
Turned off pure CO2 bubbling into high CO2 trash can. Made mixes of 10, 20, and 50 mL of high CO2 water in ~2L of low CO2 water. From these pHs, we made a regression of pH on % volume high CO2 water. To get a low pH 0.2 units below the control, we need to add 0.18% volume high CO2 water, or about 8.8 mL to 5L.
We have 2 pH treatments: high CO2 and low CO2 (pH of about 7.7 and 7.9). In each pH, there are 2 densities of oysters (4 or 8) or clams (5 or 10) per jar, in duplicate. There are also 2 control jars per pH without any animals. We took duplicate spec pH measurements of both treatments and 5 total alkalinity samples - 2 in PMEL bottles and 3 in beer bottles. The animals were put in their treatment jars around 13:30.
Wet masses were taken of groups of bivalves as they were put into their jars. The jar labels are type of animal (Cg or clam) followed by # in jar-replicate.

Low CO2:
Cg 4-1 80g
Cg 4-2 109.7 g
Cg 8-1 156.2 g
Cg 8-2 156.5 g
clam 5-1 56.3 g
clam 5-2 42.8 g
clam 10-1 90.8 g
clam 10-2 90.1 g

High CO2:
Cg 4-1 84.5 g
Cg 4-2 63.4 g
Cg 8-1 148 g
Cg 8-2 149.1 g
clam 5-1 38.1 g
clam 5-2 45.6 g
clam 10-1 88.7 g
clam 10-2 90.6 g

Dave fed all animals, 20 mL algae per jar (~60,000 cells/mL) in the evening.

OA FHL 2011
qPCR of gDNA from 9/26/11 qPCR (DH 12) and new gDNA (0627 gill tissue) using 18s, ATP synthase, citrate synthase, and new Prx6 primers. DH12 did not amplify at 18s, indicating that the results from yesterday were spurious. the new gDNA amplified at 18s, ATP synthase, and Prx6, but not at citrate synthase.


September 26, 2011
Secondary Stress Trial
Bivalves were fed at 9:30 am (see spreadsheet).
Switched from aquarium water to Mukilteo water to try to remedy low pH. Bubbled one trash can with pure CO2 and the other with CO2-free air.

OA FHL 2011
Reconstituted primers designed Sept 14, 2011 in TE buffer (pH 8.5). SR IDs are as follows: IMSP5 = 1387, 1388; ATP synthase = 1386, 1385; citrate synthase = 1384, 1383; Prx6 = 1382, 1381.
Did qPCR using all primers on gDNA (DH 12 from Sam's -20C gDNA Box 1) and cDNA (C. gigas gill vibrio exposed). All primers amplified cDNA, only IMSP5 amplified gDNA, but is probably primer dimer because it also amplified in the negative control where no other primer pair did. Also did a gradient between 50 and 57°C and all primers amplify well at 55°C. Need to make sure that gDNA was actually amplifiable by checking with 18s primers.


September 25, 2011
Secondary Stress Trial
Dave had started bubbling 2000 ppm CO2 and CO2-free air into trash cans on Saturday. Took 2 cuvettes full of water from each trash can and added 10 µL of 0.1 N NaOH to one low CO2 cuvette and 10 µL 0.1 N HCl to the other. The low CO2 water was about pH 7.87 and the high CO2 only at 7.81.

September 23, 2011
Secondary Stress Trial
Bivalves were fed at 10:20 am (see spreadsheet).
Counted clams and oysters: 205 oysters, 211 clams.
Water ammonia was at 0.25 ppm. Flushed out all excrement and did 50% water change.

September 18, 2011
Secondary Stress Trial
Bivalves were fed at 10:50 am and 6:30 pm (see spreadsheet). During morning feeding, ammonia was at 0.5 ppm. Did 100% water change and rinsed out feces/pseudofeces.

September 17, 2011
Secondary Stress Trial
Bivalves were fed at 9:45 am and 6:15 pm (see spreadsheet). One oyster was found dead at the morning feeding. During evening feeding ammonia was at 0.5 ppm. Did 80% water change.

September 16, 2011
Secondary Stress Trial
Bivalves were fed at 9:45 am (see spreadsheet).
Made F/2 media with 1 L of sterile seawater and 132 µL each of Procul A and B.

September 15 , 2011
Secondary Stress Trial
Bivalves were fed at 9:30 am (see spreadsheet). One oyster was dead.

September 14, 2011
Secondary Stress Trial
Bivalves were fed at 9:15 am (see spreadsheet).

OA FHL 2011
Two samples - both from treatment 105B (1500 µatm) taken on 8/1/11 - were extracted for demonstration purposes and discarded.

Primer design for qPCR - primers must span introns.
Since I have not been able to get rid of all gDNA in the RNA samples, I'm going to design primers that will amplify only cDNA. I have found gDNA sequence in C. gigas or a related species for Prx6 (C. gigas sequence AM265552), ATP synthase (C. gigas sequence EE677774), citrate synthase (EE677716), and IMSP-5 (a protein from the oyster shell,HS208448). I was not able to find sequence for SOD. Dave supposedly has primers that might amplify only cDNA for Hsp70, but they have not yet been tested with gDNA.
To find gDNA to align with the RNA off of which the primers were originally designed for these genes, I first did a megablast of the RNA sequence against Crassostrea sequences only. If that yielded gDNA, then I used that gene sequence and aligned it with the RNA in Spidey (indicating it was C. elegans, which probably has the most similar splice sites). If the original blast did not yield any results, then I blasted against S. purpuratus only, searching for somewhat similar sequences. If that still did not work, then I opened up the blast parameters to all organisms in genbank, searching for somewhat similar sequences. The following are the species for which I found gDNA corresponding to the RNA that I was blasting:
Prx6 - primers were originally designed off of a DNA sequence with 6 exons (C. gigas,AM265552); exons occur on DNA 38-123, 918-1074, 2091-2234, 2952-3025, 3190-3262, 3352-3483
ATP synthase - S. purpuratus (NM_214578); exons occur on mRNA sequence 262-437 and 577-623
citrate synthase - Aspergillus niger (HQ407432); exons occur on mRNA sequence 96-157 and 638-708
IMSP-5 - Lotus japonicus (AP004959); exons occur on mRNA sequence 466-563 and 611-662

Prx6 SRID: 1381, 1382
ATP synthase SRID: 1385, 1386
citrate synthase SRID: 1383, 1384
IMSP-5 SRID: 1387, 1388

September 13,2011
Secondary Stress Trial
Bivalves were fed around 8 am (see spreadsheet).

OA FHL 2011
Did spec (Nanodrop) of Dnased RNA samples (n=6). The concentrations and estimated remaining volumes of the samples are below.


September 12, 2011
Secondary Stress Trial
Bivalves were fed around 10 am and details were entered in the spreadsheet.

OA FHL 2011
Re-DNased samples that were DNased on August 22, 2011 (except for 105B/1500 ppm samples). Followed regular DNase protocol. Diluted DNAsed RNA 1:20 in nanopure water. Did qPCR using 18s primers using 1 and 2 µL of diluted RNA as template. The thermalcycler protocol is 2step amp+melt for EvaGreen.

September 10, 2011
Secondary Stress Trial
At 9:30 am, the oysters and clams were fed as described 9/9/11. The volume of algae was about 300 mL. The information was entered in the bivalve feeding spreadsheet.
Bivalves were fed again around 6 pm. Ammonia levels were checked in the water and were at 1 ppm (threshold = 0.1 ppm). Did a full water change.

September 9, 2011
Secondary Stress Trial
We got ~200 pacific oysters and 200 manila clams from Joth's farm. We put the oysters and clams in a large fiberglass tank with water circulating through a chiller to keep it at 16°C and through biofilters.
At 4pm we reduced the water in the tank to 40.5 L and fed the bivalves 60,000 cells of algae mix (from Taylor) per mL, about 575 mL. After about 1/2 hour, when the water had been cleared of algal cells, we then put the same water back in the tank.
Plans for the trial and links to data on feeding the bivalves can be found here.

September 2, 2011
Notes from Richard Strathmann on larval rearing
To make a water bath, use aquarium heater and circulating pump with a stopcock to regulate flow.
Do water changes with a sieve and bowl.
At 22°C with feeding, water changes need to be every day in a static system.
If there is flow, need to monitor amount - does the outlet have material stuck in it?
Scottie Henderson (dissertation in FHL library) used pulse food supply.
IV bag could drip food in. Could shine a light on the bag to keep culture photosynthesizing. Could also slow siphon using valve and small stopcock.
If pulse feeding, can do ad libitum, ~ >100,000 cells of isochrysis per mL (based on M. edulis), bigger cells would be less. This amount does not scale with larval age.
Possible mix for larvae: Isochrysis galbana + Pavlova lutherii or nanochoropsis or chitopserois.
Organic content is about equal to cell volume, but much larger cells have bigger vacuoles.
When collecting hatched larvae , make sure they are not malformed.
Spawning: take straight from lagoon and spawn immediately or feed and keep at a higher temperature. Can wedge open the shell and inject serotonin into the adductor (or anywhere) - may yield better eggs.
could adjust larval density for a constant biomass
Ciliates should wash out in a continuous flow.
When strip spawn, rinse tissue well with filtered seawater.
quality of food is important with sterilized seawater.
Settlement: Would be cleaner with tiles, but shell may stimulate them better. Try adding K+ or cesium ions, check concentration to get maximum effect (Yool et al. 1986 Biol Bull). Yool's results: Greater synchrony, downstream of normal sensory input, normal metabolism and good survival.
What do the lab lights do to larvae? old paper published with c. virginica.

August 25, 2011
OA FHL 2011
Nanodrop concentrations of 105A and 105B cDNA. The concentrations are very similar to 103A3 so there should be enough cDNA for a qPCR since that sample amplified well.
Redid qPCR of the 105 samples with the same primers. Also did qPCR of all samples using Hsp70 primers (SR ID 971 and 972). Protocol is 2Step Amp+Melt Eva Green.

August 23, 2011
OA FHL 2011
Nanodropped all DNased RNA samples 3 times. Concentrations were higher (~8-16 ng/µL), but this may be because the background blank of pure water is no longer a true blank after DNAsing.
Went ahead and reverse transcribed all samples. Since concentrations are so low, reverse transcribed the maximum volume (still less than 1 µg) of 17.75 µL. Added 0.5 µL Oligo dT primers to sample and incubated at 70C for 5 minutes, followed by a few minutes on ice. Then added 5 µL MMLV 5x buffer, 1.25 µL 10 DNTPs, and 0.5 µL of reverse transcriptase to each sample - mixed and incubated 42C for 1 hour + 3 minutes deactivation at 95C.

Did qPCR of cDNA using 1 µL template a full concentration (equal volume pooled cDNA from all samples), diluted 2x, 4x, and 10x for a dilution test. Primers used were superoxide dismutase (SR ID 600 and 601) and EF1a. qPCR protocol used was 2Step Amp+Melt Eva Green (annealing = 55C).

All NTCs were clean. The only samples that amplified were EF1a full concentration and 2x dilution.

Did qPCR using the same EF1a and SOD primers, glutathione peroxidase (Rachel's primers from 441), and peroxiredoxin 6 (SRID 634 and 635). Used 2 µL of full concentration cDNA template. Did positive controls of gDNA and cDNA.

All NTCs were clean. The 105A and 105B samples did not amplify. It's not a problem with the primers because there was amplification of the 103A and 103B samples and positive controls.

August 22, 2011
OA FHL 2011
DNased all RNA samples (Ambion's Turbo Dnase kit, regular protocol). Due to low concentrations of RNA had to DNase entire volume of RNA. Diluted DNased RNA 1 µL in 19 µL water for qPCR test of gDNA contamination. Stored DNased RNA in -80•C.
qPCR of DNased RNA using 18s primers. Did qPCR using 1 and 2 µL of RNA template (both diluted 1:20).

gDNA contamination in all samples, but NTCs were clean.

August 19, 2011
OA FHL 2011
qPCR of RNA extracted August 18 to check for genomic DNA carry-over. Diluted RNA 1:20 and 1:10 and amplified in 20 µL reactions using Sso Fast EvaGreen mix. The thermal cycler program used was 2 Step Amp+Melt EvaGreen.
There was gDNA contamination in all the samples (NTCs were clean). All samples need to be DNased.


August 18, 2011
OA FHL 2011
Extracted RNA from all samples collected July 26, 2011. Used Tri Reagent and followed manufacturer's protocol. Did not see any pellets in any of the samples. Resuspended the RNA in 0.1% DEPC, 50 µL and pipetted 3 times to mix. Nanodropped RNA 3 times (1 µL each) per sample to get concentration. All concentrations are very low and entire volume will need to be used for reverse transcription. RNA is stored in NOAA OA May-June 2011 box in -80C.


OA NOAA August 2011
NOAA is doing another OA experiment with 6 different treatments: 400, 600, 800, 1000, 600 +/- 200, and 800 +/- 200 µatm. They are rearing C. gigas larvae in each of the treatments. I sampled 2 entire jars per treatment for RNA analysis. The entire jar volume was decanted onto a 20µm mesh sieve. The larvae were washed down into a small volume at the bottom of the sieve and transferred to a 2 mL tube. The tubes were spun down at 4,000 rpm for 1 minute. The water was drawn off and remaining material was flash frozen on dry ice. The samples were stored at -80C at NOAA.

August 17, 2011
OA FHL 2011
I spent the last week counting the larvae I fixed during the OA experiment, assessing levels of calcification and measuring the larvae. Polarization was used for calcification and it doesn't look like there is much of a difference between treatments. For measurements, shell hinge length and depth were measured at 10x using CF's Nikon. Using a two-sided t-test in R, there is a significant difference in hinge length between 400 and 1000 µatm on day 3 and a difference in shell depth between the control larvae and all treatments on day 3 (4 days post-fertilization). p-values are in pink on the images; on the shell depth graph, all p-values refer to a comparison between that treatment and 400 µatm. The colors correspond to the following treatments: blue = 400, green = 700, yellow = 1000, orange = 1500.



August 9, 2011
Ceramide
Steven's stats for gene expression data

August 8, 2011
Ceramide
Assembled information for a table in the manuscript that includes gene accession number (sptlc1=JN315146, 3KDSR=JN315143, AC=44, GlcCer=45), sequence length, similar oyster ESTs and top blast hit in NCBI. The similar oyster ESTs were found by doing a blastn of the amplified nucleotide sequence, selecting "other EST" and constraining the search to C. gigas. The top blast hit was found by running a blastx of the nucleotide sequence within the swissprot database.

August 5, 2011
OA FHL 2011
Started counting samples from 1st timepoint of experiment - 7/25 1 hour post fertilization. Counted total number of eggs in each tube, number of eggs that have evidence of a polar body or fertilization envelope (indicating successful fertilization), and cleavage stage if present. The fixation seemed to work well, but there are fewer eggs than I expected in each sample. Entire sample is emptied from the tube into a welled plate and then 0.5 mL of 70% EtOH is used to rinse out the tube into the well. When done counting, the entire volume from the well is pipetted back into the tube and the well is rinsed with 0.5 mL of 70% EtOH.

Ceramide
qPCR of tissue distribution of the second set of primers for 3KDSR (3KDSR qPCR.2).


August 4, 2011
OA FHL 2011
Finished fixation of samples from 8/3.

August 3, 2011
OA FHL 2011
End of experiment
Did TA and spec pH on cooler water and 2 containers in 105B (because flow is still a problem in these containers).
From each remaining container, took 2 separate aliquots of 2x 1000 µL each for live/dead counts. Filtered out remaining larvae and fixed in PFA (fixation finished 8/4).

August 2, 2011
OA FHL 2011
Ran all remaining total alkalinity samples and DIC. Took and ran spec pH and TA for all 4 coolers.
Fed larvae by putting in 30 mL of hatchery algae mix and turning off water for 2 hours.

August 1, 2011
OA FHL 2011
Sampled 2 containers for RNA and counting from each treatment: 103A-5, 103A-6, 103B-1, 103B-2, 105A-4, 105A-5, 105B-2, 105B-3. Containers were chosen because they had the highest densities based on last week's counts for the 4 remaining larval containers in each treatment. Larvae were spun down in 2 mL of water and flash frozen in liquid N2. For counting, 4 aliquots of 500 µL were taken per container and for fixation, 2 aliquots of 500 µL was taken.
Counts were done for live/dead and totals. Photos were taken for SEM: 9 photos for 103B, 10 for 103A, 5 for 105B, and 1 for 105A (there was only one larva counted in all the subsamples taken for the 105A treatment).
Samples were taken from the cooler water for DIC, TA and spec pH. For each container sampled for RNA, water chemistry was done (pH and TA).
Some samples from previous days were run for TA and DIC.
The larvae were fed ~60,000 cells per mL of the hatchery algae mix by turning off the water flow for 2 hours.

July 31, 2011
OA FHL 2011
Laura Newcomb fed the larvae with 50 mL of each Iso. and Dunaliella, leaving water shut off to system for 2 hours.

July 29, 2011
OA FHL 2011
Finished total counts of larvae sampled 7/28. Also took SEM of the same larvae: 7 larvae photographed from treatment 103A, 10 from 103B, 5 from 105A, and 4 from 105B.

Took salinity and temperature from all outside cooler water and took spec pH of same water.

Sampled containers for RNA (emptied all larvae onto mesh, poured into 2 mL vial, spun down for 1 min at 2,500 rpm and flash frozen): 103A-3, 103A-4, 103B-3, 103B-5, 105A-1, 105A-2, 105B-4, 105B-6.

Finished fixation of larvae from 7/26 and 7/28.

Fed larvae as described 7/27.


July 28, 2011
OA FHL 2011
Crisis at 6 am - cooler 106B pH was down to 6.5. Switched containers over to 105B, which had been pre-equilibrated at 7.52 starting yesterday. Took a spec sample to see how low pH had gotten within the container (sample was of 106B-3). The containers will stay permanently in 105B. Without temperature correction, the pH in 106B-3 was about 6.8.

Sampled all containers for counting (3x 500 µL aliquots). Live/dead counts were done today, but total counts will be done tomorrow morning (as well as SEM!). Sampled containers 1, 3 and 4 for fixation with PFA (2x 500 µL aliquots).
Took pH and TA samples from containers 3 and 4.
Took pH, TA and DIC samples from outer cooler water.

Used what I thought was a 50 µm mesh sieve for the first container (103B-1), but I think it was actually much larger because no larvae were retained. Switched back tot he 35 µm for the remainder and larvae were present in every well.

Ran total alkalinity for cooler water samples collected 7/25 and 7/27 (8 samples).

Made new 4% PFA in seawater.

July 27, 2011
OA FHL 2011
Made new 50 µm mesh for outflows on 105A and 106B (see 7/26). Took samples for DIC, TA and pH and ran DIC from 7/25 and 7/27. Fed larvae.

Continued fixation of larvae from yesterday. Only did 2 PBS washes, leaving larvae in second wash at 4C.

Around 11 am we ran out of CO2 and all the pHs went to ~8 in all the treatments. Moose and I installed another cylinder, and the systems re-adjusted, but in most cases the pH was overshot and went too low before it re-equilibrated. All seem OK now.

At 11:30 am took samples from outer cooler water for DIC and TA and measured, salinity, temperature, and took spec pH.

Counted algal cells for larval feeding. Counted 3 squares in hemacytometer, 25 of which equal one square millimeter. For Dunaliella, there were ~366 cells per square mm and for Isochrysis ~ 216 (diluted 1:1 and 2:1, algae : EtOH, respectively). This scales up to 1.8 million cells per mL for Dunaliella and 1.3 million for Isochrysis. To feed the larvae approximated 45 million cells oof each (30,000 cells per mL in a 3 L container), they need 24 mL of Dunaliella and 34 mL of Iso. At 4 pm, turned off water flow and fed larvae. Turned water flow back on at 6 pm. Tubing has not arrived yet, so had to feed larvae by adding food and turning off water flow for 2 hours.

At 6 pm, took spec samples from outer cooler water and salinity and temperature.

Ran DIC for all samples collected 7/25 and 7/27 standardizing against CRM 111.

July 26, 2011
OA FHL 2011
Finished fixing samples from 7/25. Cleaned and replaced water in all tanks, started on flow-through. Took samples for counting live/dead and fixing for scope work later. Took chemistry samples (TA and pH) of all outer cooler water and inside 2 containers for each treatment.

Details:
Finished the fixation process from 7/25. Removed the PFA and washed 2x with 1x PBS, letting stand 15 minutes in between each wash. Then washed in increasing concentrations of EtOH: 30, 50, and 70%, again letting stand 15 minutes between each. Left larvae in the 70% EtOH and stored at 4C.
Around 8:30 in the morning, took samples for spec pH from the outer cooler water of all treatments and from the following larval containers: 106B-2, 105A-2, 105A-3, 103B-1, 103A-2, 103A-4, 103B-3, 106B-3. Also took samples in Pyrex bottles (poisoned) for total alkalinity.
In turn, emptied each larval container onto a 35 µm mesh sieve and then rinsed the larvae from the sieve into a 50 mL Flacon tube. Filled the tube to 50 mL with the appropriate pCO2 SW. Inverting 3x between each aliquot, aliquoted 450 µL (3x 150 µL)of larvae in seawater into a gridded welled plate. Aliquoted the same amount into a 2 mL microcentrifuge tube and added 7.5% MgCl2 for 15 minutes. Then followed same steps as 7/25 for PFA. For the larvae in the welled plate, counted live vs. dead on an inverted scope (went to 32x to verify mortalities) and total counts.
Later in the afternoon, noticed that some of the containers in tanks 105 and 106 were overflowing. The problem seemed to be caused by not enough outflow from the containers. Tried to fix the problem for most of the evening and replaced most of the containers with new ones that had good flow around 1 am. By 2 am, all containers seemed to be holding a good volume and not overflowing. At 6:45 am on 7/27 came back and a couple containers looked like they were overflowing again. Replaced all the outflow mesh with 50 µm and the problem seems to be fixed.

July 25, 2011
OA FHL 2011
Took spec pH of the cooler water and of the water in one larval container for each treatment (6 am). Recalibrated the Durafet probes based on the spec pH for the cooler water. Turned off flow through on larval containers.
At 7:30 am, collected 31 adult C. gigas from Argyle Creek. Strip spawned 10 females and 4 males, separating sperm and eggs.
Fertilization (in the correct pCO2 water) began around 10:30 am. About 90,000 eggs were fertilized with about 1200 sperm.
The fertilized eggs were incubated for 10-15 minutes to allow fertilization to occur and were then rinsed into the static larval containers (static for 24h).
Fertilization of the falcon tubes used to monitor development and take samples for fixation within the first 24 hours begain at 11:25 am and proceeded as follows for each of the treatment coolers (2replicates fertilized per cooler):
106B - 11:25 am
105A - 11:40 am
103A - 11:55 am
103B - 12:10 pm
The fertilized eggs were left to incubate for 10 minutes and then put into 40 mL of seawater at the correct pCO2. The tubes were placed in the coolers that contain the larval containers. At one hour post fertilization (hpf), the Falcon tubes were gently inverted 3x and 500 uL were aliquoted into a microcentrifuge tube (this was repeated for a total of 1 mL). The fertilized eggs were allowed to settle to the bottom of the tube for 5 minutes, then the seawater was drawn off and 1 mL of 4% paraformaldehyde (PFA) was added. The tubes were left to sit overnight.
Starting at 5:25 pm (6 hpf) when there was evidence of the larvae hatching into the trocophore stage, the same steps were repeated except the larvae were all strained onto a 35 µm mesh screen and rinsed using 1 mL of SW into a tube. 1 mL of 7.5% MgCl2 was added to relax the larvae and they were left to sit for 15 minutes. The SW + MgCl2 was then removed and replaced with 1 mL of 4% PFA, left to sit overnight.

At 2:30 pm, samples were taken in 500 mL Pyrex bottles for carbonate chemistry from each cooler. Samples were also taken for spec and temperature and salinity were measured with probes.


July 24, 2011
OA FHL 2011
Reset settings on tanks for new treatments. All are at 21C and the pCO2 are at 400, 700, 1000, and 1500 µatm.

July 23, 2011
OA FHL 2011
Tank 103 is adjusted to the correct pH levels as is tank 106B. Tanks 105 and 106A are not appropriately equilibrating. Tank 106A was not flowing through and so was not allowing turnover of water - replumbed it and seems to be getting a little better. Turned off the CO2 to tanks 105 so that the pH could come up. Moose also fixed a problem with the vacuum compressor, which may help as well.
Temperature is not getting high enough on any of the tanks (does not go above 22 C). On tanks 103, put a heater in the cooler that contains the cooling coil (set at 24C) to try and warm the incoming water. Each cooler containing the experimental replicates has 1 500W heater, it may be that they each need 2.

July 22, 2011
OA FHL 2011
Made new m-cresol purple: dissolved 0.016 g of m-cresol purple (MW = 404.4 g/mol) in 20 mL of milliQ water to make 2mmol/L solution. Brought to pH ~7.9 using 0.1N HCl. Did a dye addition correction using 4 samples of seawater, 2 with added HCl for a pH range (10 µl and 20 µl).
The slope (b) = -1.415
The intercept (a) = 0.996

Durafet pH probe calibration: Each tank has a Durafet probe attached to the pump that measures the pH of the water in the tank. These need to be calibrated with the spectrophotometric pH. Turned off the water flow into the coolers around 9 am and let the water circulate through the pumps for ~1/2 hour. Took one cuvette of water from each tank to measure pH using m-cresol purple (MCP). Calibrated temperature for each probe using the Fluke thermometer. Tanks 103 A and B were at 10C, 105 A and B were 10.4C, and 106 A and B were 10.2 and 10.3 C, respectively. pH measured at 25C was adjusted for dye addition (see above) and adjusted for temperature using CO2calc and assuming that total alkalinity = 2060 µmol/kg. Probes were calibrated to the correct pH as follows:

TANK	MEASURED pH	ADJUSTED pH
103A	7.76	7.98
103B	7.76	7.98
105A	7.78	7.99
105B	7.79	8
106A	7.77	7.99
106B	7.76	7.98

After calibration, tanks were set to the appropriate treatments outlined July 18, 2011.

July 21, 2011
OA FHL 2011
Turned on water in coolers and set flow through larval containers around 11:30 am.

July 20, 2011
OA FHL 2011
Washed all larval containers and lids using vortex and fresh water. Made 35 and 50 µm large screens and 35 µm small screens.

Made 7.5% MgCl2 in MilliQ water (0.7877 mol/L). Dissolved 7.49 g of MgCl2 (MW = 95.2115 g/mol) in 100 mL of water.

Made 1x PBS from 10x PBS (from Jaquan) by mixing 10 mL of 10x in 90 mL of DI water. Brought the pH down to 7.4 with 1N HCl. The 1N HCl was made from 10N HCl - 20 mL of 10 N HCl in 180 mL of DI water.

Made 4% paraformaldehyde in filtered seawater. Each ampoule of 16% PFA is 10 mL - mixed with 30 mL of FSW.

July 19, 2011
OA FHL 2011
Cleaned out all 6 coolers to be used for the experiment. Emptied all water in the coolers and wiped down with vortex. Let sit with the vortex for >5 minutes. Wiped down twice with fresh water.

"Larvae-proofed" the 36 larval chambers for the experiment. All chambers have an outflow of ~1/2" diameter near the top of the container. I hot glued mesh of 35µm on the outflow so that larvae would not be able to escape.

Working on a detailed experimental protocol and materials list for the experiment. It can be found here

July 18, 2011
OA FHL 2011: Choosing pH for OA experiments
The coolers representing different treatments need to be set at specific pH that represent the correct µatm treatments for CO2 in seawater. These values depend on total alkalinity (TA), salinity, and temperature. Students in the OA class have measured the TA and salinity of the incoming water into the tanks. TA = 2060 µmol/kg, salinity = 30.1 ppt. All measurements are taken at 25C. For each temperature treatment, the adjusted conditions are set to the correct T (24 or 28C). Constants used in CO2calc are Lueker et al. 2000 for CO2 constants, Dickson 1990b for KHSO4, Total pH scale, Wanninkhof 1992 for air-sea flux (Dickson, pers. comm.) pH at which the Honeywell controllers will be set are:
24C, 400 µatm: 8.04
24C, 700 µatm: 7.84
24C, 1000 µatm: 7.69
28C, 400 µatm: 7.98
28C, 700 µatm: 7.78
28C, 1000 µatm: 7.64

June 17, 2011
How to measure total alkalinity

• Find a clean, dry 200 mL beaker
• Rinse beaker 3 times with a small amount of water from your sample (dispose of rinse water properly)
• Fill beaker with sample to ~130 mL
• Zero balance and weigh beaker with water and zero again. Remove beaker from balance, pour the sample into the insulated beaker on the stir plate and place empty beaker on the balance. The sample weight is the absolute value of the number on the balance display. Record the sample weight.
• Stir contents of insulated beaker with a magnetic stir bar. Place TA and temperature electrodes in the sample. The sample should warm to 25 +/- 0.1 degree C.
• Click “initialize instrument” in Controls tab.
• When temperature is attained, enter the salinity and weight of the sample into the Controls tab in LabView. Click “begin titration”
• An initial pulse of HCl will be added, then none for 2-5 minutes, then small pulses. The TA measured by the two different electrodes should be within 4 units of each other.
• When TA measurement is done, rinse probes over sample with DI water and pat gently with kimwipes. Do NOT touch the electrodes on the bottom of the probes.
• Use the peristaltic pump to suck out the water from the beaker into the SW + HCl waste. Rinse the insulated beaker with DI water a few times and turn off pump when done.
• Without touching the inside of the insulated beaker, remove the stir bar with a kimwipe. Wipe out 3 times with kimwipes to dry

Making m-cresol purple
M-cresol purple needs to be kept at 4C once the powder is dissolved because the dye degrades in water over time. The concentration of the dye for a 10 mL cuvette should be 2 mmol/L, or 0.04044 g in 50 mL of nanopure/milliQ water. The dye needs to be brought to 7.9 +/- 0.1 pH, or the ratio of the absorbance peaks at 434 and 578 wavelengths should be ~1.6. This can be achieved by adding NaOH or HCl. The pH is determined by spec using a short path length (1 cm) cuvette at 25C.

June 13, 2011
NOAA OA: C. gigas larvae
The frozen larvae are stored in a freezer box in the -80C. They are on the second shelf from the bottom (currently on the righthand side). The tubes are labeled on the side with the jar, treatment, and date of collection. The three treatments are 280, 400, and 1000 ppm.

Ceramide: qPCR
Designed new primers for 3KDSR qPCR (3KDSR_qPCR.2, 1341 and 1342 SRID). The primers were reconstituted with TE buffer (pH 8.5) to 100 uM. qPCR was done on 2 cDNA samples and 3 negative controls to test primers. The cDNA amplified and had a single melt curve; the NTCs were blank.
qPCR was done on all control and vibrio-exposed samples (n=8 for each treatment) in duplicate.
All samples amplified. One NTC had amplification that could be problematic. The difference in expression between control and vibrio-exposed is not significant (p=0.07).


June 6, 2011
NOAA OA: C.gigas larvae
Details about sampling
Jars counted: 3A4, 3A5, 3B4, 1A4, 1A5, 1B4, 6A4, 1B5, 3B5, 6A5, 6B4
All jars sampled for RNA
Spec done for jars: 1B4, 1B5, 3B4, 3B5, 6B5, 6A5
Counts:
counts were done for live/dead, calcification, and size. Aliquots used for counting were 6x1000 uL divided between 2 wells. Calculations were done as described May 19. Calcification data were taken on June 7. As for June 1, there were barely any larvae left in the 1000 ppm treatment and densities were low in all jars.
For the samples taken for RNA for 1A5 and 1B5 there were many shell bits that were too hard to remove without compromising the sample.
3A4 was the only jar that was first filtered with 180 um mesh to get rid of rotifers (it didn't seem to help much since the rotifers were still there, they were probably able to squeeze through the mesh).
The algae used to feed the larvae had crashed but was still being delivered into the larval chambers.
Copepods had proliferated in some of the jars and I saw many copepod eggs and some copepodites.
The wells corresponding to 6B4 were completely covered by rotifers. When EtOH was added to these wells, the rotifers created a solid mat on the bottom.

June 1, 2011
NOAA OA: C.gigas larvae
Details about sampling
Jars counted: 1A4, 1A5, 1B4, 1B5, 3A4, 3A5, 3B4, 3B5, 6A4, 6A5, 6B5
No jars sampled for RNA
Spec done for jars: 1A4, 1A5, 3A4, 3A5, 6A4, 6A5
Counts: counts were done for live/dead, calcification, and size. Aliquots used for counting were 3x 1000 uL. Calculations were done as described May 19. Sarah took size pictures for plate 2, wells A2, B2 and C2 on June 2. Trends included: a number of the jars at 1000 ppm had no larvae at all; there was no obvious trend in number of larvae swimming per treatment or in calcification or mortality. Since the anomalous results at previous time points for the 1000 ppm treatments drive the trends, it seems that the lack of data for this time point results in no obvious trends. The absence of larvae could be due to a mass mortality event between May 27 and June 1.

Rotifers were in all jars counted and were very dense in some. This distracted from counting. The rotifers also "kick" the larvae, which seems to cause the larvae to close their valves and cease swimming. In 6B4, there was so much algae and rotifer bodies that it was difficult to see the larvae.

May 27, 2011
NOAA OA: C.gigas larvae
Details about sampling
Jars counted: 1B3, 3B3, 6B3, 1B6, 3B6, 6B6, 1A4, 3A4, 6A4, 1A5, 3A5, 6A5, 1B4, 3B4, 6B4, 1B5, 3B5
Jars sampled for RNA: 1B3, 3B3, 6B3, 1B6, 3B6, 6B6*
*There are two tubes for 6B6 because there was so much algae in the sample that the volume couldn't be reduced enough on the sieve to fit in one tube.
Spec done for jars: 1B3, 3B3, 6B3, 1B6, 3B4, 6B6
Counts: counts were done for live/dead, calcification, and size. Aliquots used for counting were 3x450 uL. Calculations were done as described May 19. Calcification for plate 4 was done on May 28 (in the morning around 7:30 am). Trends included: slightly greater number of larvae swimming in the 1000 ppm; fewer completely calcified larvae at 1000 ppm and greater partially calcified and uncalcified; overall least amount of total mortality at 1000 ppm but the single jar with the greatest total mortality was also at 1000 ppm; inconsistent instant mortality.
Rotifers were observed in almost all the jars. There was a lot of algae in the jars from treatment 6, box B. Jar 6A5 was dropped and ~1/3 of the contents spilled. The jar was refilled with water and replaced in its box. Around 9 pm, ~60 g of adult C. gigas shell fragment were placed in all the remaining jars. In one box for each treatment, two jars were put in the system with only water and 2 jars with water and 60 g of shell fragment to monitor changes in total alkalinity.

May 23, 2011
NOAA OA: C.gigas larvae
Details about sampling
Jars counted: 3A3, 3B3, 3A6, 3B5, 3B6, 3A6, 3A5, 6A3, 6A6, 6B3, 6A5, 1A6, 1A3, 1A5, 1B5, 1B3, 1B6
Jars sampled for RNA: 3A3, 3A6, 1A3, 1A6, 6A3, 6A6
Spec done for jars: 1A3, 3B3, 6A3, 1A6, 3A6, 6A6
Counts: counts were done for live/dead, calcification, and size. Aliquots used for counting were 3x333 uL (1 mL). Calculations were done as described May 19. Trends observed included: greater number of larvae swimming in the 1000 ppm; lower % calcified larvae at 1000 ppm; higher % partially and uncalcified larvae at 1000 ppm, lowest uncalcified at 280 ppm; greater total and instant mortalities at 1000 ppm. Rotifers had somehow gotten into the jars in treatment 6 (400 ppm). Ciliates were observed in some jars.

May 19, 2011
NOAA OA: C.gigas larvae
Details about sampling
Jars counted: 3B1, 3B2, 3B3, 3B4, 3A3, 3A4, 6B1, 6B2, 6B3, 6B4, 6A3, 6A4, 1B1, 1B2, 1B3, 1A3, 1A4, 1B4.
Jars sampled for RNA: 3B1, 3B2, 6B1, 6B2, 1B1, 1B2
Spec done for jars: 1B1, 3B1, 6B1, 1B2, 3B2, 6B2
Counts: counts were done for live/dead and calcification. Photos were taken for size for plate 6. Sarah took photos for the other plates the next day (5/20). Aliquots used for counting were 7x100 uL (700 uL). Calculations and graphs were made to observe trends for % swimming larvae, % calcified, % partially calcified, % uncalcified, total mortality, and instant mortality. Since the number of empty shells were recorded, it is possible to separate out the larvae that have died recently (instant mortality) from those that have died over the course of the experiment but have just been counted (total mortality). % swimming is based on the total larvae, including the empty shells. All the calculations for % calcified, etc. are based on total larvae excluding the empty shells. Observed general trends include: more larvae are swimming at 1000 ppm; more larvae are totally calcified at 400 ppm > 280 ppm > 1000 ppm; more larvae are partially calcified and uncalcified at 1000 ppm; total and instant mortalities arehighest at 400 ppm and lowest at 1000 ppm. Ciliates were present in some jars.

May 18, 2011
Ceramide sequencing
Analysis/incorporation of new sequences
3KDSR to include stop codon: Assembled all previously sequenced reverse sequences. Based on alignment with the new reverse sequence (R2), deleted all Ns and the first 6 bp (GCCCTT) from the consensus (1626). Assembled with R2 and made consensus (1627). Assembled all previously sequenced forward sequences and made consensus (1628). Made reverse complement of the contig 1627 and assembled with the forward contig (1628) to make consensus full sequence 1630. Trimmed at bp 111 to start with ATG. Based on majority rule, base pairs were changed in the contig 1630 to have certainty in protein translation: bp 904 = G, bp 936 = G, bp 964 = C. Translated and trimmed amino acid sequence to include first stop codon at aa 329.
Sptlc1 missing middle 26 bp: Sequenced purified gel band of Sptlc1 PCR (F and R) and resequenced plasmid prep from before (F and R) for 4 new sequences. Assembled all previous and new F and R sequences - F contig is 1631, R is 1632. They did not align. Aligned them with the original Sptlc1 EST and there are still 10 bp missing in the middle of the sequence.

NOAA OA: C.gigas larvae
Shallin and Mike showed me how to take samples for PMEL to test total alkalinity (TA) and dissolved inorganic carbon (DIC). The jars (500 mL) are from PMEL and are made to be nonporous.
1. label the jars with a paint marker: "NWFSC/UW dd/mm/yy Tank #"
2. Grease the stopper and smooth out the grease by moving the stopper in the neck of the jar
3. Make sure the equilibrator pump is on and attach tubing to outlet from equilibrator.
4. Let water flow out the tube for at least 1 minute.
5. Rinse bottle well, upside down so water flows out.
6. Fill bottle completely with water from tank and let overflow for at least 5 seconds (about equal to half the volume of the bottle).
7. Pinch off tube tightly and quickly remove from jar. It is important to have adequate headspace so that the water does not overflow after the poison is added. Turn off water flow.
8. Poison jar with mercuric chloride (Shallin does this) and put in stopper.

May 16, 2011
NOAA OA: C. gigas larvae
The NOAA side of the experiment ended on Sunday (May 15) and our experiment now has access to 1 more box (=6 more jars) per treatment. The sampling schedule has been updated and is in the google doc of the sampling data.
When I came in Monday morning, there was no water flowing to the jars in treatment 3 (280 ppm). Paul says that they had trouble with that tank on Sunday and that it probably stopped working Sunday night. After doing the pH spec, I verified that the pH in the jars had not been adversely affected by the static water. The jars were all moved to tank 4, which had been previously equilibrated to 280 ppm. The jars are still labeled as treatment 3 jars (i.e. 3A1 as opposed to 4A1) but will remain attached to tank 4 for the remainder of the experiment.
Sampling for May 16:
Total jars sampled for RNA - 1A1, 1A2, 3A1, 3A2, 6A1, 6A2
Jars counted (5 aliquots of 100 uL from the Falcon tube) - 1A1, 1A2, 3A1, 3A2, 6A1, 6A2, 1A3, 1B3, 6A3, 6B3, 1B1, 1B2, 3B1, 3B2, 6B1, 6B2

Details about sampling
RNA: All larvae were removed from jars using a 20 um mesh sieve. Larvae were transferred from the sieve into a 2 mL tube with 1-2 mL of seawater. The tube was spun down at 5,000 rpm for 1 min and the seawater was removed. The larvae were then flash frozen in liquid N2 and later transferred to the -80C freezer.
Counting: Counts were done for live/dead, calcification, and size. In some of the wells (both wells for 1A1 and one well for 1A2) too much EtOH was added and it was difficult to find the partially/uncalcified larvae, so their representation may be missing from the final counts. For these wells, shells were fully calcified if they had they full D-hinge shape and were partially calcified if the shell was very small/was not the correct shape. No uncalcified larvae were found in these wells (which is unrealistic since it is the 1000 ppm treatment). All other wells were easy to score. For size, photos were taken of ~10 larvae per well on the dissecting scope (5x) of larvae that were positioned in the well so that a clear "D" shape was visible when looking down at them. Photos were taken 5.17.11. Measurements have not yet been taken.

Other notes
All larvae were D-hinge or close to (kidney bean shaped) if calcification was apparent. Partially calcified larvae ranged from small dots of calcified material on the larval body to a full shell that did not show a well formed cross under the polarized light.
Empty shells were included in counts of mortality, but not calcification.
There were ciliates in some wells/jars (see data sheet).
There seemed to be more algae in the jars from treatment 1 (1000 ppm) - maybe because the higher pCO2 is causing the algae to grow in the jars?

May 13, 2011
NOAA OA: C. gigas larvae
Sampled 2 jars from each treatment and took data on microscope.
Began cleaning and sampling jars around 8:30 am. Cleaning was accomplished as described for May 10, 2011. Aliquots for counting were 3x 60 uL (180 uL). Calcification amount was also determined on the inverted microscope using double polarization. A few pictures were taken as examples of different levels of calcification: full, partial, uncalcified. Data can be found in link from May 10. Eggs were not included in total counts. A couple of ciliates were seen in one well from jar 3B2. Jar 6B5 was sampled in its entirety for RNA due to low densities of larvae in most of the jars from shelf 6. In general, densities are much lower than expected and the sampling schedule will have to be adjusted accordingly.
Samples were taken for gene expression analysis from 6 jars: 1B1, 3B1, 1B2, 3B3, 6B2, 6B5. After preliminary density counts for each jar, the correct volume for the desired number of larvae (10,000 or 5,000) was taken from the 50 mL Falcon tube. This volume was filtered through a 20 um sieve and then pipetted into a 2 mL screw cap tube. The larvae were left to sit for ~1 min, tapped a few times on the counter to encourage larvae to go to the bottom, and then most of the seawater was pipetted off before the larvae were flash frozen in liquid nitrogen. The samples were later transferred to a -80C freezer, but it appears that the dewar had run out of liquid N2 and the samples may not have good quality RNA.

Larval feeding began Thursday at ~4 pm, except for box 3B which was started Friday morning (and given a surplus of food at that time).

May 10, 2011
NOAA OA: C. gigas larvae
Began cleaning and sampling jars around 8:30 am. Each jar was completely emptied into a 20 um mesh sieve and then rinsed out with the appropriate treatment water. A new, clean jar/larval chamber was filled with new water from the appropriate treatment and if that jar was not scheduled to be sampled, all larvae were rinsed into the new jar. If the jar was scheduled to be sampled (jars 5 and 6 for May 10), then a clean jar was prepped while larvae were washed into a 50 mL Falcon tube, which was then filled to 45 mL. The tube was gently mixed ~5x, 3 aliquots of a fixed volume were taken and put into a welled plate (1 well) and then these two steps were repeated so that for each jar sampled there were 2 wells of a fixed volume to count. For shelf 1, the volume taken was 45 uL x3, for shelves 3 and 6 the volume was 25 uL x3 (135 uL yielded too many larvae). After the aliquots were taken from the Falcon tube, it was poured into the new, clean jar and replaced in the appropriate box. At the end of sampling all the jars, they were plugged into the system so that the water would flow through.
Counting of larvae began ~10 am. First, live/dead were determined on the inverted microscope at 40x. Then the larvae were dropped with 100% EtOH and total counts were taken per well on the inverted scope at 4x. Count data are here
Shallin did pH spec on the system and jars for demography.
Jars were plugged into the system (flow-through) ~4 pm.

Treatment 1 = 1000 ppm
Treatment 3 = 280 ppm
Treatment 6 = 400 ppm

May 9, 2011
NOAA OA: C. gigas larvae
Carolyn and Brent went to Taylor and fertilized eggs for the experiment. 21 females and 20 males were used in the fertilization. 80,000 eggs were aliquoted to each jar for transport (each jar would then be emptied into the larger larval chambers at NWFSC) and the eggs were fertilized in the jars with pooled sperm. We began putting the fertilized eggs into the chambers containing treatment water around 5 pm (treatment pCO2= 280 ppm, 400 ppm 1000 ppm). The system is being kept at 14C. Fertilized eggs in the larval chambers were left static overnight so that the larvae could hatch.
2 jars (~80,000) fertilized eggs were strained on 20 um mesh and stored at -20C for pop gen.

May 3, 2011
C. gigas larvae: OA & Vt
extracted 2 samples for RNA: 1 control and 1 10^6 Vt. First spun down briefly at 5,000 xg and removed seawater supernatant. Then extracted with TRI reagent according to manufacturer's protocol. Resuspended in 50 uL 0.1% DEPC H2O and mixed by pipetting. Checked RNA concentrations on Nanodrop, doing each sample in triplicate. Average concentrations are reported below.
control: 27.03 ng/uL
10^6 Vt: 30.68 ng/uL

S. glomerata: OA
Extracted 2 samples for RNA: D9 B6, and D16 B6 from the sample set in the 2 mL tubes. Spun down at 5,000 xg for 2 minutes and removed larvae/sediment into a new tube. Saved supernatant in a 2 mL screw cap in -80C. Followed TRI reagent protocol. Resuspended in 50 uL 0.1% DEPC H2O and mixed by pipetting. Checked RNA concentrations on Nanodrop, doing each sample in triplicate. Average concentrations are reported below.
D9 B6: 0.10 ng/uL
D16 B6: 0.36 nguL

April 29,2011
NOAA OA: C. gigas larvae
Raw data from experiment April 11-18, 2011.

April 27, 2011
Ceramide: sequencing
Made 1% agarose plate (100 mL 1x modified TAE, 1 g agarose, 10 uL EtBr). Loaded 25 uL of PCR product into wells and used Bioline's Hyperladder. Ran for ~1 hour at 100V. Cut out gel bands from first 4 lanes. The contamination seen in the Sptlc1 is the same size as the desired product, so it should not adversely affect sequencing efforts. A new bottle of sterilized nanopure water was started yesterday - the new and old water in the different negative controls refers to this bottle ("new") and the bottle that had previously been in use ("old").


Ceramide: qPCR vibrio exposure
To confirm contamination of qPCR primer stocks for 3KDSR, did a cPCR following the qPCR thermal profile: 95C 10 min; 40x 95C 15s, 55C 15s, 72C 30s; 95C 10 min; 72C 10 min. The new bottle of sterilized water was used. The 10 uM working stocks for 3KDSR qPCR made 4.26 were used as well as the qPCR primers for acid ceramidase, which have never showed signs of contamination. Ran PCR products on a 1% agarose gel at 120V for 30 min. The primer stocks for 3KDSR are contaminated as evidenced by the amplification of the correct product size in the negative controls (which is not seen for acid ceramidase). Will order new primer stocks.


C. gigas larvae: OA & Vt
At 10 am (~24 hours post-inoculation) counted live vs. dead in the welled plates. There was differential mortality between the treatments. At ~2:30 pm, sampled all the jars in the experiment (vibrio exposure control and 10^2-10^6). Filtered entire 200 mL through a 30 um mesh screen and rinsed out jars with sterile seawater. Pipetted all larvae condensed in one corner of the screen into a screw cap tube. Flash froze in a mixture of dry ice and EtOH. Transferred tubes to the -80C box O.orca archived tissue from NWFSC.

April 26, 2011
C. gigas larvae: OA & Vt
Put ~2000 larvae in each jar and dosed with Vt (between 10:30 and 11:30 am). Also aliquoted 40 larvae into welled plates and added appropriate pCO2 seawater to bring volume to 4 mL. Larvae in plates were also dosed with Vt.
Elene measured pH in each of the treatments using the spec. There wasn't much different between the treatments and the lowest pH was 8.09. Terminated the 2000 ppm and 840 ppm experiments, kept ambient to do LD50 with just Vt. Set up sterilized seawater bubbling with CO2 at 750 and 2000 ppm overnight to begin LD50s tomorrow.

Ceramide: qPCR vibrio exposure
Repeated qPCR of 3KDSR from 4.22. Used new nanopure water for everything. Bleached bench and got new mat. Made new working primer stocks. Used a new plate and new immomix.
NTCs still had contamination.

Ceramide: sequencing
Designed new primer to capture more of the 3' end of 3KDSR (Cg_3KDSRseq_R2). Also need to try to get missing middle 26 bp for Sptlc1. Made pooled cDNA for controls and 3-hour post exposure C. gigas gill samples. Did PCR on pooled samples with new 3KDSR reverse primer and original forward primer and with Sptlc1 primers (12.5 uL Apex, 8.5 uL water, 0.5 uL each primer, 3 uL cDNA; GENPCR in Emma's directory).

April 25, 2011
Ceramide: qPCR vibrio exposure
Box plot includes previous data for loci EF1a, Sptlc1, acid ceramidase, and acid sphingomyelinase. 3KDSR and ceramide glucosyltransferase are new based on April 22's qPCRs. The expression difference between control and exposed for 3KDSR is significant; the different is not significant for Cmglctrans (see zoomed in graph below). Significance is based on t-tests in R.


C. gigas larvae: OA & Vt
Set up system in basement to do a LD50 with 3 levels of CO2 (ambient, 840 ppm, and 2000 ppm) and 6 concentrations of V. tubiashii (control, 10^2 CFU through 10^6 CFU). There are 2 replicate jars for each Vt concentration within each pCO2 for a total of 12 jars in each pCO2. Each jar holds 200 mL of sterilized filtered seawater. The jars were placed in airtight boxes with an inlet for the correct pCO2 and an outlet attached to tubing with the other end in water so that atmospheric air does not enter the box (see pictures below). At ~3:30 pm the boxes were sealed and the air was turned on so that the water in each jar will equilibrate to the correct pCO2. Also ~200 mL of water in a beaker was placed in each box that will serve as water in the plates to be used for counting.

April 22, 2011
Ceramide: qPCR vibrio exposure
qPCR of 3KDSR and ceramide glucosyltransferase (CgT) of vibrio-exposed adult C.gigas gill tissue, 3 hours post-exposure. PCRs are of all 16 samples, 8 control and 8 exposed, in duplicate. Thermalcycler protocol was 3StepAmp+Melt_SJW.

Results: 3KDSR was contaminated (high amplification of NTCs), CgT was not. Both primer pairs amplified only one product (one melt curve).

Made new working stocks of 3KDSR (10 uM) and did a qPCR of all samples in duplicate.

Results: Still slight amplification in the NTCs but it comes up much later than the other samples. Only one melt curve apparent at 75-75.5.

April 19, 2011
NOAA OA: C. gigas larvae
Took calcification data from the samples taken April 18. Some notes of concern: 1. a good number of mortalities were empty shells, meaning that the larval body had dissipated or been eaten - if uncalcified larvae suffered a similar fate they would be underrepresented in the counts. 2. the ethanol added to make the larvae drop can make cells lyse, which makes distinguishing unshelled larval bodies from debris difficult.

April 18, 2011
NOAA OA: C. gigas larvae
Sampled all jars of larvae and changed water as outlined on April 12, 2011. Step 3 was again changed and 3 aliquots of 333 uL were taken for counting. The experiment was ended and all remaining larvae were strained from the water and preserved in RNAlater for analysis. Calcification data were not taken today but samples were saved to do tomorrow.

April 15, 2011
NOAA OA: C. gigas larvae
Sampled all jars of larvae and changed water as outlined on April 12, 2011. Changes to the protocol include: 3 aliquots of 50 uL were taken for counting (step 3); a greater volume of larvae were removed for RNA isolation and were preserved in RNAlater (step 4); calcification data were taken.

April 14, 2011
Ceramide sequencing: alignment and phylogenies
Serine palmitoyltransferase
Trimmed protein sequence to end with stop codon (468 amino acids). Aligned with protein sequences of C. elegans, D. melanogaster, D. rerio, H. sapiens, and M. musculus in ClustalX. Imported alignment into Geneious and made tree in PHYML.


Updated all protein alignments and trees to include homologous genes from C. elegans, D. rerio, Xenopus spp., M. musculus, and H. sapiens. Not all sequences were available for all genes.

April 13, 2011
Ceramide sequencing: alignment and phylogenies
Serine palmitoyltransferase
As mentioned below (April 7, 2011), the forward and reverse sequences for Sptlc1 do not overlap. There is a 26 bp gap between the two sequences. I generated consensus sequences from the contigs for the forward and reverse fragments (n=3 for each) and then assembled them to the original EST (which is made up of FQ665912 and 454 ESTs).
Reverse complemented the consensus sequence and translated starting from the first sequence ATGTAT ( TAT = amino acid Y) based on how the translation of the original EST aligned with homologous sequences.

April 12, 2011
NOAA OA: C. gigas larvae
Yesterday, Carolyn picked up diploid C. gigas larvae that were fertilized on 4/11 at about noon. They were brought to NOAA and put in the system at 6 pm. There are 3 treatment pCO2 (280, 400, 1000 ppm) and 3 replicates per treatment. They are being held at 14C.
Starting around 9 am today, we began sampling each container (n=9) and Shallin took samples to determine the pH on the spec. Sampling involves the following:
1. Pour entire container through a 20 micron mesh sieve that is in a water bath (of the water you are pouring through). Rinse out the container with the correct treatment seawater 3x.
2. Rinse the larvae on the mesh into a 50 mL falcon tube and fill to 45 mL.
3. Invert the falcon tube gently 5x and take 3 aliquots of 30 uL (could be greater volume if larvae are less dense) and put in a welled plate. Which containers go in which wells is randomized.
5. Take 750 uL of water + larvae from the falcon tube and strain through mesh (should be >500 larvae). Remove larvae from mesh with a pipette and put in 2 mL screw cap vial and flash freeze.
4. Blind counts are done for number larvae dead, number alive but on bottom of well, total larvae (and then by subtraction, the number swimming), and calcification level (uncalcified, partially, or fully). Total larvae and calcification data are taken after the larvae have been dropped by EtOH. Calcification is determined using a polarized lens on the inverted scope. Mortality is verified at 40x.

No calcification data were taken today because the larvae were still too young to be calcified. The larvae are so small that there are probably not enough frozen for qPCR.
Tomorrow, feeding will begin for all the larvae.

April 8, 2011
Ceramide sequencing: alignment and phylogenies
Acid ceramidase
Generated consensus sequence from alignment in Geneious. Most of the beginning and end of the sequence are Ns, the start codon (ATG) is at bp 89 and the stop codon (TAA) ends at bp 1258. Translated consensus nucleotide sequence into a protein sequence and exported FASTAs of C. gigas protein with protein sequences from GenBank for C. elegans, D. rerio, H. sapiens, and R. norvegicus. Aligned all sequences in Clustal and imported the protein alignment back into Geneious. Using the PHYML plug-in, generated a phylogenetic tree using the JTT algorithm, 100 bootstraps, 0 invariable sites, and 1 substitution rate category.



Ceramide glucosyltransferase
Same as for ACMase. The reverse complement of the sequence was used to generate the protein sequence. On the reverse complement, the ATG was 38bp after then Ns. The alignment was performed with sequences of CgT for H. sapiens, X. tropicalis, and C. elegans.


3-ketodihydrosphingosine reductase
Same as above. The start codon was at bp 112 in the consensus sequence. Alignment was done with sequences from H. sapiens and D. melanogaster.


April 7, 2011
Ceramide sequencing: alignment and verification
Serine palmitoyltransferase (Sptlc1)
Got back good quality sequence for 3 forward and 3 reverse. There are a few potential SNPs in the sequences. The fragments sequenced with the forward primer assemble together, as do the fragments sequenced with the reverse primer. When these 2 contigs are aligned with the original contig based on ESTs, there are ~25 bp missing between the two sequenced fragments.

Ceramide glucosyltransferase
Got back good quality sequence for 2 forward and 3 reverse fragments. All fragments assembled together to form a full sequence that assembles with the original (reversed) EST.

Acid ceramidase (ACMase)
Got back good quality sequence for 4 forward and 4 reverse fragments. All fragments assembled together and aligned with the original EST used to design the primers.

3-ketodihydrosphingosine reductase (3KDSR)
Got back good quality sequence for 8 forward and 7 reverse fragments. All fragments assembled together and aligned with the original contig used to design the primers.

March 31, 2011
C.gigas Larvae Vibrio exposure
Almost all larvae were dead in all treatments (including control), probably due to ciliates which had proliferated overnight.

March 30, 2011
C.gigas Larvae Vibrio exposure
Counted larvae to determine mortality. Only counted larvae on the bottom of the well. On the last day of the experiment we will count total larvae in each well by dropping them with EtOH and then retroactively determine the number of swimming larvae for previous days. Dead vs. live larvae were determined at 40x magnification.

March 29, 2011
C. gigas Larvae Vibrio exposure
Elene got 2 week-old larvae from the hatchery yesterday. This morning, we aliquoted ~40 larvae into wells of tissue culture plates and made sure the volumes in each well were at 4 mL. Different plates were inoculated with 10^3, 10^4, 10^5, 10^6, 10^7, or no V. tubiashii (control) that Elene had grown over the weekend. Plates were left on the benchtop to incubate over night.
March 24, 2011
Ceramide sequencing: cloning
SR cloned 4 PCR products for acid ceramidase and 4 for ceramide glucosyltransferase. I did the plasma minipreps today following the same protocol outlined March 8, 2011 except the spinning for 13,000xg was actually done at 13,000 rpm. The DNA and primer plates for sequencing were updated with the new plasmids and primers.

March 18, 2011
Ceramide sequencing: cloning
Pooled equal volumes of control oyster gill tissue at the 3 hour time point for the PCR. Each PCR reaction had 12.5 uL Apex, 8.5 uL water, 0.5 uL each primer, and 3 uL cDNA. Primers used were ceramide glucosyltransferase and acid ceramidase (also NTCs). Ran on program GENPCR (Emma directory).
Made 1.2% agarose gel (50 uL 1xTAE, 0.6 g agar, 5 uL EtBr). Loaded 5 uL of Bioline's Hyperladder and 10 uL PCR product and ran 100 V for ~30 min.
Observed band sizes corresponded to expected sizes: 1080 bp for ceramide glucosyltransferase and 1165 bp for acid ceramidase. Cut out bands and stored at -20 C in cDNA III box.


March 9, 2011
Ceramide sequencing: cloning
Checked the colonies from the re-cloning started on 3.7.2011 and there were not many so let them grow until today. Still very few colonies. Only one dark blue colony grew on the plates streaked with the Bioline cells. Only dark blue colonies on the TOPO cell plates. Fail :(

Ceramide: tissue distribution
Below are the graphs of the tissue distribution of gene expression for the genes identified in the ceramide pathway. qPCRs were done on 3.8.11 (ASMase), 12.14.10 (Sptlc1), and 3.1.11 (3KDSR, CMglctrans, ACMase). All data were analyzed in PCR miner and are averages across duplicate Cts. Expression values are normalized to EF1a (qPCR 11.30.10).


March 8, 2011
Ceramide sequencing: cloning
Qiagen miniprep for Sptlc1 and 3-KDSR. Clones grew well in LB+kan overnight - all tubes were cloudy so did minipreps of all 11 samples.
Put 1.5 mL of LB mixture in an eppie tube, spun at max speed for 2 minutes, decanted supernatant, added 1.5 mL more and repeated.
Added 250 uL P1 buffer to pellet and vortexed to resuspend.
Added 250 uL P2 and inverted 4 times.
Added 350 uL N3 and inverted 4 times immediately. Spun at 13,000xg (should have been rpm) for 10 minutes.
Put supernatant in Qiagen column and spun at 13,000xg for 1 minute.
Added 750 uL of PE buffer to column, spun at max speed 1 minute. Removed flow-through and spun again at max speed. Put column in new eppie tube.
Added 30 uL EB buffer to column, incubated at RT 1 minute, spun down at max speed 1 min.
Stored eluted cDNA at -20C.

Ceramide: qPCR
qPCR for tissue distribution of acid sphingomyelinase (I don't believe the results from the previous qPCR since ASMase is expressed in gill tissue as evidenced by the PCRs done for vibrio exposure).

Results: NTCs are clean. Distribution was the same as seen previously: high expression in the digestive gland and very low in other tissues. See 3.9.2011 for graph.

March 7, 2011
Ceramide sequencing: cloning
All colonies grew on gridded plates over the weekend. Two of the no-template controls in the PCR evaporated (for acid ceramidase and 3-KDSR).
Made a 1.2% agarose gel (1.2 g agar, 100 mL 1xTAE, 10 uL EtBr) and loaded 10 uL of PCR product into wells. Ran at 100V for ~40 min.

The two primer pairs with colonies that amplified, Sptlc1 and 3-KDSR, had only one product and it is of correct size for both primers (see 3.3.2011). None of the light blue colonies amplified the correct product for any of the primer pairs. The two NTCs were clean. Filled sterilized glass tubes with sponge stoppers with 5 mL of 1XLB + 50 mg/mL Kanamyacin (made by MG 12.22.09). For each of the restreaked white colonies (Sptlc n=3; 3-KDSR n=8), touched a sterilized toothpick to the colony and then dropped it in a tube. Incubated the tubes at 37C, 250 rmp overnight.

Recloning of ACMase and Cm glucosyltransferase. Same protocol as 3.3.2011 (see for details) using the purified PCR bands from that day as template (verified presence of DNA in PCR product). Instead of using just One Shot TOP 10 competent cells (TOPO), doing a comparison with Bioline's CH3-Blue Chemically Competent cells.


March 4, 2011
Ceramide sequencing: cloning
7:30 am : only a few colonies have grown, mostly on the plates spread with 200 uL. Will let grow until this afternoon.
1: 30 pm : more colonies and larger, but still very few white colonies.
Gridded LB+kan plates to restreak picked colonies. Picked colonies (details below) with sterile plastic wand and put wand tip in 50 uL of aliquoted master mix (25 uL Apex, 23 uL water, 1 uL each primer). PCR CLNY program on SBR directory: 94C 8 min; 40x 94C, 45s, 50C 1 min, 72C 1 min 30s; 72C, 10 min. Left restreaked plates on benchtop to incubate over the weekend.
Ceramide glucosyltransferase: 3 light blue colonies, 1 dark blue
Sptlc1: 3 white colonies, 5 light blue, 1 dark blue
acid ceramidase: 1 light blue, 1 dark blue
3-KDSR: 7 white colonies, 1 dark blue

March 3, 2011
Ceramide sequencing: cloning
Made LB for plates: 100 mL 5x LB (lab stock) + 400 mL nanopure water + 7.5 g Bacto Agar in a large flask. Swirled to mix and covered with foil. Autoclaved 20 min at 121C (sterilization only). Let cool on bench until cool enough to touch for ~30s. Added 500 uL of Kanamyacin (50 mg/uL), swirled to mix and filled plates. Covered plates and let cool on bench until set. Stored at 4C in plastic sleeve.

PCR for sequencing. Made two pools of cDNA, control and vibrio exposed, from 3 hour time point (gill tissue). 3 uL of each sample (n=8) went into each pool. Made master mixes for primers of full-length gene product for acid sphingomyelinase, 3-ketodihydrosphingosine, acid ceramidase, serine palmitoyltransferase 1, and ceramide glucosyltransferase. Master mixes included (per reaction) 12.5 uL Apex mix, 8.5 uL water, 0.5 uL of each primer, and 3 uL of cDNA. Thermocycler conditions (GENPCR in Emma's directory) are 1. 95C, 10 min, 2. 95C, 30s, 3. 55C, 30s, 4. 72C, 30s (back to 2 x39), 5. 72C, 10 min.
Ran 10 uL of PCR products on 2% agarose gel (100 mL 1xTAE, 2 g agarose, 10 uL EtBr) at 100 V for ~45 minutes. The vibrio exposure and negative control samples amplified with ceramide glucosyltransferase primers evaporated a bit and were reconstituted with 10 uL of nanopure water and loaded on gel.

Acid sphingomyelinase primers did not amplify a product. All other product sizes match up well with expected sizes.

Cut out bands for each of the amplified control PCRs. Spun them down in millipore ultrafree tubes at 5,000xg for 10 minutes (NB: do not use 2% gels in the future because they do not easily go through the funnel of the tubes.) In a strip tube put 2 uL of PCR product, 0.5 uL of salt soln (TOPO kit), and 0.5 uL vector (TOPO). Incubated at 22C for 10 min on thermocycler and then put on ice. Thawed competent cells on ice while incubation at 22C. Added 2 uL of PCR mix to competent cells, swirling while adding. Put on ice for 10 minutes, then heat shocked at 42C for 30s, then on ice for 2 min. Added 250 uL of room temp SOC in hood, rolling tubes on side to coat. Taped tubes on side in shaker at 37C, 225 rpm for 1 hour.
Put 8 LB+kan plates at room temp. Spread plates with 80 uL of XGAL (20 mg/mL) and dried in oven at 37C. Spread 2 plates for each gene - one with 50 uL of transformed cells and one with 200 uL. Let dry with lids cracked at 37C and then incubated overnight upside down.

March 1, 2011
Ceramide qPCR
qPCR of tissue distribution in mantle, muscle, digestive gland, and gill (samples extracted 10.27.10) using primers for acid ceramidase, ceramide glucosyltransferase, and 2-ketodihydrosphingosine reductase in duplicate. Also qPCR of control and vibrio-exposed 3 hour time point gill samples using acid sphingomyelinase primers (duplicate). Thermalcycler protocol was 3StepAmp+Melt_SJW.

Results: Single melt curves for each gene and NTCs were clean. Data were analyzed in qPCR miner. Gene efficiencies were good except ceramide glucosyltransferase had an average 69.6% efficiency. Others were 3KDSR 86.1%, ceramidase 90.1%, and sphingomyelinase 89.9%. For sample E8 (SMase) one of the replicates was wonky and so the expression value was thrown off and the sample was not included in the analyses. There is no significant difference in expression for acid sphingomyelinase between control and vibrio-exposed oyster gill at 3 hours post exposure. The outliers for both control (C5) and exposed (E6) had consistent Ct values across both PCR replicates and are most likely true expression values.


Environmental monitoring
Retrieved PSDs from Discovery Bay at 9 pm, tide height = 0'6". Samplers were found easily by following rope to which the cinder block was attached. Both samplers were still free from sediment and submerged. After retrieval, PSDs were stored at -20C.

February 16, 2011
Environmental monitoring
Deployed 2 PSDs at site described below at 8:40 pm, low tide height -1'1".

February 15, 2011
Environmental monitoring
Went to Discovery Park to find a good spot for PSD deployment. The treatment plant touches both North and South beaches. North Beach has calmer water and seems to be less trafficked by park users. There is a small beach before the main beach that looks to be a good place for deployment. The cinder block with 2 attached POCIS will be tied to a rope that is anchored at the shore line near some rocks (see schematic below). PSDs have been mounted in vegetable steamers for deployment.
Map of Discovery Park and deployment site.


Beach deployment plan.


Northeast view of Shilshole from site.



February 14, 2011
Environmental monitoring
Got 2 PSDs (POCIS) from Irv Schultz. Brought back to Seattle and stored at -20C.
Went to assess Fort Lewis site yesterday. The site is on the military base and there are a few signs that say it is closed after dark as well as a number of gates that could potentially be closed. Irv says that the gates have not been closed when he is there at night, but I have decided it's risky and on the wrong side of legal so I am choosing another site.
The West Point Treatment Plant is the largest wastewater treatment plant in King County (circled in pink below).

The outfall from the plant is ~3000 ft offshore and 300 ft deep.

The plant is located in Discovery Park. I'm going out this afternoon to look around and see how accessible the shoreline near the plant is for deploying PSDs. There are low tides Tues, Wed, and Thurs nights this week.

February 10, 2011
Vibrio exposure/ceramide: qPCR
qPCR using primers acid ceramidase and 3-KDSR. For ACMase, PCR'd all 3 hour gill samples, control and exposed, in duplicate. For both primer pairs, PCR'd control and exposed from 1 hr time point (n=4).

Results:
Acid ceramidase, all samples - significantly different expression between control and exposed (p=0.045)

Acid ceramidase and 3-ketodihydrosphingosine reductase, 1 hour timepoint n=4 for exposed and control - no significant differences in expression at this time point.


February 8, 2011
Vibrio exposure/ceramide: qPCR
qPCR using new primers, 3-ketodihydrosphingosine reductase, ceramide glucosyltransferase, and acid ceramidase on gill tissues from vibrio exposed and control oysters (n=4 for each treatment with each primer pair). 1 uL of cDNA and 24 uL of master mix were used for each reaction.


Results: All primers amplified product and had one melt curve. All NTCs were clean. A number of the samples for ceramide glucosyltransferase came up very late and as a result 1 control and 2 exposed were set to 0 expression level for the analysis. The other Cts were >42 and may not be trustworthy, although they were analyzed in Miner. If these primers are to be continued they need to be optimized.
None of the differences between treatments were significant (n=4 for control and vibrio exposed) although there is a trend for upregulation of these genes in vibrio exposure, except for ceramide glucosyltransferase.



February 7, 2011
Vibrio exposure: qPCR
Results from qPCR 2.3.2011: All samples amplified and NTCs were clean. Analyzed data in qPCR miner and calculated expression values for each sample using equation 1=1/(1+AER)^Ct. Calculated normalized expression for Sptlc1. Box plot of expression values below. Blue boxes are for 1 hour time points and green boxes are for 3 hour. There is no difference between treatments at any time point, but there is a trend for increased expression of Sptlc1 in the exposed group at 3 hours.



Ceramide: new primers
Received primers described 2.2.11. Made new TE buffer pH 8.5 as described 1.11.10. Reconstituted all primers to 100 uM.

Vibrio exposure/Ceramide: qPCR
qPCR using EF1a and Sptlc1 primers on gill samples from vibrio exposure experiment, 3 hour time point. All sampled qPCR'd in duplicate.

Results: calculated expression values as described above. Normalized expression of Sptlc1 is barely insignificant for increased expression in vibrio exposed versus control.


February 3, 2011
Vibrio exposure: qPCR
Diluted all cDNA 4x (72 uL water + 24 uL cDNA). Using EF1a (SR ID 309) and Sptlc1 primers for samples C1-4 1 hour, E1-4 1 hour, C1-4 3 hours, and E1-4 3 hours.


February 2, 2011
Vibrio exposure: reverse transcription
qPCR from 1.31.2011 showed possible (although very little) gDNA contamination in samples: Gill C2 1 hour, gill E2 1h, gill E2 3h, muscle C2, mantle C1.
Reverse transcribed all gill samples, control and exposed, from 1 and 3 hr time points (n=32). To 14 uL of DNased RNA (~1 ug) added 0.5 uL oligo dT primers and 3.75 uL of water. Incubated at 70C for 5 minutes. Put rxn on ice for a few minutes then added to each well: 5 uL MMLV RT buffer, 1.25 uL dNTPs, 0.5 uL MMLV reverse transcriptase. Incubated at 42C for 1 hour, heat deactivation 95C for 3 minutes. Stored cDNA in Emma's cDNA Box III.

Vibrio exposure: qPCR
Made pooled samples of control and exposed gill cDNA (across 1 and 3 hour time points, n=16 in each pool). 1 uL from each sample was put in each pool. qPCR was done using EF1 and Sptlc1 primers on the pooled cDNA at full concentration and diluted 2x, 4x, and 10x from control and exposed samples for each primer pair.


Results: All dilution factors amplified for both genes, although EF1a had much lower Ct than Sptlc1 (see table below). A 4x dilution will probably work well for these samples and the genes we are testing. PCR miner successfully analyzed all the data.



Environmental monitoring
Talked to Irv Schultz about pilot study to test PSDs in salt water (again) and possibly generate preliminary data for a grant. The plan is to pick 1 or 2 sites, between which 3 PSDs will be divided. The PSDs will be put out for ~3 weeks and upon retrieval, we will also trap a few crabs to look at bioaccumulation in the hepatopancreas. The possible sites are:
1. Fort Lewis: sewage discharge is near Solo Point, Take exit for base and go west to solo point road and enter the fort, the road will dead end at the park. About 1/4 mile south is a pipe from the treatment plant that discharges waste ~100 ft below the surface offshore. Need a pretty low tide to deploy PSDs. The first negative tide for February is the 15th (see tides).
2. Bremerton naval base: can approach outfall from the Bremerton ferry dock.
3. a marina
4. Myrtle Edwards Park (my suggestion) is near a combined sewer overflow.

Ceramide: in silico search for full-length sequences
Continued from 1.31.2011
I took detailed notes on everything that I did but the wiki didn't save them. I will paraphrase the work and my findings below. The form of the methods used was similar to those described in detail on 1.31.2011.

Neutral sphingomyelinase
Assembled novel 454 DB hits with previously found ESTs. 2 contigs were made, one with 40 reads and one with 6. The one with 40 blasts to NSMase, the one with 6 does not have a match in SwissProt. The new contig is still missing coding sequence on the 5' end.

3-ketodihydrosphingosine reductase
Through adding 454 sequence data, the entire coding sequence was assembled for this gene.

Ceramide synthase (Lass6)
Through assembly of C. gigas EST with 454 sequences, found start codon (entire 5' end) but still missing ~18 amino acid residues from the 3' end of the sequence.

Designed primers for sequencing and qPCR of 3-ketodihydrosphingosine reductase (SR ID for sequencing primers: 1188 & 1189; for qPCR: 1186 & 1187), ceramide glucosyltransferase (sequencing SR ID: 1178 & 1179, qPCR: 1180 & 1181), and acid ceramidase (sequencing: 1182 & 1183, qPCR: 1184 & 1185).

January 31, 2011
Vibrio exposure
qPCR with 18s primers of DNAsed RNA from SJW for adult C. gigas 1 and 3 hr post-vibrio exposure.


Ceramide: in silico search for full-length sequences
Ceramide glucosyltransferase
Created a custom database in geneious with the 6-day-old larval transcriptome data from 454 sequencing (now called "454 DB"). Did megablast of longest EST from ceramide glucosyltransferase (the other ESTs lay within the long one). Got 6 454 ESTs that matched to original, assembled all and extracted consensus sequence. blastx of consensus EST against swissprot database Xenopus tropicalis ceramide glucosyltransferase (Q5BL38.1), e = 2e-53 and protein coding starts before bp 98 on C. gigas EST query. Through protein alignment, found start codon at bp 35 of contig, so translated from bp 35 to get final protein coding sequence for C. gigas. blastp returns top hit of ceramide glucosyltransferase (gene structure).

Acid ceramidase
blasted (megablast) EST AM856720.1 against 454 DB and returned a lot of ESTs. The first 5 top returns did not add significantly to the original ESTs found 1.29.2011. Did megablast of contig of original 4 ESTs found on GenBank against 454 DB but the top 5 hits did not extend the sequence at all.
blastx of original contig (contig 1597 in geneious) on NCBI. Top hit was rat acid ceramidase (Q6P7S1.1) and protein coding in the alignment began at bp 69. Extending to start codon at bp 15 looks like it encompasses the entire protein sequence.

Neutral sphingomyelinase
454DB megablast of HS230283.1 returned a lot of hits. Assembly with the top 5 extends the sequence a little in the 3' direction. Assembly with the top 10 extends the original sequence in both directions. Extract the consensus and blastx - top hit is C. elegans neutral sphingomyelinase (O45870.2, e=5e-59) with protein coding in the alignment starting at bp 10. there is no start codon at or before 10 bp and alignment of the amino acid sequences shows that there may be ~80 aa residues (>200 bp) missing from the C. gigas sequence on the 5' end.
Assembled all the megablast return (n=22 + original EST) and generated consensus sequence. Did megablast of consensus


January 29, 2011
Ceramide: in silico search for full-length sequences
Continuation of work from 1/28/2011 to find available full-length cDNA for the constituents of the ceramide pathway.
Ceramide glucosyltransferase/glucosylceramide synthase: makes glucosylceramide from ceramide
Homologene number 37763. H. sapiens and C. elegans (cgt-1) align with 48% identity - pretty good.
blastn of C. elegans mRNA (NM_074570.3) against C. gigas nucleotides and ESTs yielded no results.
tblastn of C. elegans protein ( NP_506971.2) against C. gigas ESTs returned top hit HS163638.1 (mixed adult tissues). E value was 5e-50 and EST covers only part of protein sequence. Protein coding in alignment begins at bp 47 of C. gigas EST, so translated the sequence and did pblast. top hit is xenopus ceramide glucosyltransferase (Q5BL38.1), e=3e-58, with very good coverage.

Uploaded with Skitch!

blastn of C. gigas EST HS163638.1 against other C. gigas ESTs to see if mRNA can be extended at all. Returned 2 more ESTs - FP003616.1 and FP009071.1. Neither EST adds any length to the original.

Ceramide kinase: makes ceramide 1-P from ceramide
Homologene 11247
Aligned protein sequences: C. elegans shows poor identity (27%) with H. sapiens; D. melanogaster has better identity (32%) and D. rerio and H. sapiens share 46% identity.
blastn of D. rerio mRNA (NM_001105586.1) against C. gigas nucleotides and ESTs yields no results.
tblastn of D. rerio protein (NP_001099056.1) against C. gigas ESTs brings back HS203383.1 (e=4e-15) but coverage is poor. tblastn with D. melanogaster protein sequence similarly returns FQ661838.1 (e=3e-24), but coverage is poor. These 2 ESTs do not form a contig.

Glucosylceramidase(/cerebrosidase?)
homologene 10859
Alignment of C. elegans and H. sapiens proteins shows ~37% identity between the two. D. melanogaster and H. sapiens share 43% identity.
blastn of D. melanogaster mRNA (NM_176041.1) against C. gigas nucleotide and ESTs returns no results.
tblastn of D. melanogaster protein (NP_788055.2) against C. gigas ESTs returns CU996255.1, but it only covers the last 200 bp of the protein sequence (e=7e-69). not going to pursue this one further

Acid ceramidase: makes ceramide from sphingosine
homologene 10504
H. sapiens and C. elegans protein sequences share 38% identity. H. sapiens and D. rerio share 59%.
blastn of C. elegans mRNA (NM_060772.7) against C. gigas nucleotide and ESTs returns no results.
tblastn of C. elegans protein (NP_493173.1) against C. gigas ESTs returns top hit AM854720.1 (e=2e-72) with excellent coverage of the protein sequence.

Uploaded with Skitch!

Protein coding on the alignment begins at bp 4 of the C. gigas EST. Translated sequence and did blastp. Returned acid ceramidase from Pan troglodytes (A5A6P2.1), e = 1e-89.
blastn of C. gigas EST AM854720.1 against other C. gigas ESTs returned 5 EST hits: HS193380.1 (e=0), FP005089.1 (4e-175), HS193379.1 (1e-135), HS210738.1 (1e-119), CU682703.1 (7e-73). The first 3 hits all assemble to add more length to the original EST.
Extracted the consensus sequence and did blastx. Top hit is human acid ceramidase (e=4e-110) with good coverage. Translated sequence beginning at bp 75 and did blastp. Top hit was H. sapiens acid ceramidase (Q13510.5, e = 1e-100).
blastn of consensus EST against other C. gigas ESTs. Along with previous returns for blasts of this sequence, 2 novel ESTs were retrieved: CU682444.1 (e=0) and AM854478.1 (2e-46). Assembled with contig but AM854478.1 did not assemble and CU682444.1 only added a few bp.

Neutral sphingomyelinase
homologene 2652
H. sapiens and A. gambiae share 40% identity.
blastn of A. gambiae mRNA (XM_310670.4) against C. gigas nucleotide and ESTs yielded no results.
tblastn of A. gambiae protein (XP_310670.4) against C. gigas ESTs returned mixed adult tissue HS222394.1 (e=8e-74) with patchy coverage. Second hit HS230740.1 has slightly more complete coverage of the protein and an equally strong e-value (2e-70), so will use that sequence for further searches. Coding in the protein alignment begins at bp 13. Translated sequence and did blastp. This sequence corresponds to factor-associated with neutral sphingomyelinase activation, so start over with actual enzyme.

homologene 31129
H. sapiens and C. elegans proteins align with 43% identity.
blastn of C. elegans mRNA (NM_060768.3) against C. gigas nucleotides and ESTs
tlbastn of C. elegans protein (NP_493169.2) returned a top hit HS230283.1 (e=2e-46) with OK coverage. Protein coding in the alignment begins at bp 13, so translated mRNA and did blastp of protein sequence. Top hit is C. elegans putative NSMase (O45870.2, e=2e-46)
blastn of C. gigas EST HS230283.1 against other gigas ESTs returns 4 ESTs: AM864642.1 (e=7e-142), AM863597.1 (1e-135), HS230284.1 (1e-79), FP002080.1 (7e-8). All 4 ESTs added significant length to original.

Uploaded with Skitch!

Extracted consensus sequence and did blastx. Top hit is D. melanogaster putative NSMase (Q9VZS6.2, e=3e-62). The protein corresponds to the first ~900 bp of the C. gigas contig. Translated bp 34-879 of contig (coding sequence that corresponds to Dmel protein). blastp of this translated sequence also returns putative NSMase.
blastn of trimmed contig against C. gigas ESTs does not return any novel ESTs.

3-ketodihydrosphingosine reductase
homologene 1539
H. sapiens and D. melanogaster share 35% identity.
blastn of D. melanogaster mRNA (NM_143106.2) against C. gigas nucleotides and ESTs returned nothing.
tblastn of Dmel protein (NP_651363.1 ) against C. gigas ESTs returned 3 overlapping ESTs that span almost the entire length of the protein: AM853669.1 (e=9e-46), AM863021.1 (5e-30), AM857772.1 (4e-15). Only the first 2 assembled into a contig.
Extracted the consensus sequence (950 bp) and did blastx. Top hit is H. sapiens 3-KDSR (1e-84). Protein coding in the alignment starts at contig bp 134 and blastp of this translated segment returns 3-KDSR. blastn of the trimmed contig against other C. gigas ESTs does not return any novel sequences.

January 28, 2011
Ceramide pathway protein phylogeny
Based on Steven's alignments, found full protein coding sequence for sptlc1 in C. gigas.

Search for full coding region in Acid Sphingomyelinase
Human acid sphingomyelinase isoform 1 (SMPD1) accession number is NP_000534.3, homologene 457
aligned sequence with C. elegans (isoforms 1 and 2), C. familiaris, D. melanogaster and A. gambiae - there is a lot of homology between the vertebrates H. sapiens and C. familiaris, but less homology between the invertebrates and between verts and inverts.

blastn searches using C.elegans mRNA sequence for isoform 1 (NM_063014.5) of C. gigas nucleotide and EST sequences on GenBank yielded no returns.
tblastn of C. elegans protein sequence for isoform 1 (NP_495415.2) came up with C. gigas hits in the EST database (not nucleotide). The top hit was HS200764.1 (e=2e-45), but there was poor coverage of the sequence.

tblastx returned the same sequence as tblastn (e=9-50) but also with poor sequence coverage.
tblastn using H. sapiens protein sequence of the C. gigas ESTs also returned HS200764.1 (e=9e-72) with slightly better coverage, but still not complete.


Contigs from 454 sequencing data that matched to SMase are 21728 and 37057. blastx of both match to SMase 3b in M. musculus (P5824.1, e=8e-56) and human (Q92485.2, e=1e-75), respectively. Both contigs were trimmed and translated to match their top blast hits.
Homologene for SMase 3b is 8708. Protein sequences for C. elegans and H. sapiens show only 34% identity. tblastn of C. gigas ESTs with the C.elegans protein sequence returns HS199021.1, but the coverage isn't very good (e=5e-24). Putative SMase 3b Xenopus protein sequence is also in homologene (XP_002939398.1). tblastn of C. gigas ESTs returns the same EST as C. elegans but with much better coverage (e=1e-42).

megablast of HS199021.1 returns no other C. gigas EST hits.

Find a better gene....
Ceramide synthase 6 (Lass6) is highly conserved across taxa. Homologene #72228. H. sapiens and D. rerio sequences share 89% identity; Hsap, Drer and P. marinus (lamprey) share 65% homology. (P. marinus sequence is translated from an embryo EST starting at bp 6, accession number EG337115.1). blastn of D. rerio mRNA (XM_688191.3) against C. gigas nucleotides and ESTs yields no results. tblastn of D. rerio protein against C. gigas ESTs returns a number of hits, the top one being HS185280.1 (e=3e-55). According to the alignment, the coding regions overlap at C. gigas bp 58. pblast of this translated sequence returns as a top hit Lass6 (Q8C172.1, e=2e-65). blastn of the C.gigas EST returns 15 other C. gigas ESTs, but they all overlap completely and are of the same origin - mixed adult tissue libraries.


January 27, 2011
Ceramide pathway protein phylogeny
translated sptlc1 sequence to a stop codon in Geneious. This ends up being the translation of the reverse compliment of bp 1036-1821. the top pblast hit is serine plamitoyltransferase (1e-84).

January 25, 2011
Ceramide pathway protein phylogeny
Both the SMase and Sptlc1 protein sequences are missing some important amino acid residues that would be necessary for making a complete comparison with homologous proteins. SR found 5 C. gigas SMase sequences that align with the original EST. I did the alignment in Geneious and did a tblastx of the consensus sequence. The 3rd hit was D. rerio acid SMase 3b-like (e=6e-75). The alignment of our C. gigas sequence with the D. rerio started at bp 398, so I trimmed the consensus sequence and translated it in Geneious. I then did a pblast with the SwissProt db of this protein sequence, which returned protein information for acid SMase, the top hits being human, mouse, bovine, amoeba, and C. elegans acid SMase 3b-like. For information on protein structure see here. I redid the protein alignment in Clustal (with the same protein sequences previously used) and remade a phylogenetic tree in Geneious.

A pblast of the translated protein of Sptlc1 described 1.19.2011 also returned protein information in NCBI, found here.

January 21, 2011
Ceramide qPCR: SMase
qPCR of adult C.gigas tissues, vibrio exposed adult gill, and OA larvae.

Results: All amplified well and NTCs were clean.

January 20, 2011
Ceramide pathway protein phylogeny
Redid Sptlc1 tree with mRNA sequence translated in Geneious (same method as for SMase). Used all same protein sequences as previously described.

Ceramide qPCR: SMase
Received new SMase primers and reconstituted to 100 uM with TE buffer. qPCR using new SMase primers (CU995168_SMase) of adult C. gigas gill, mantle, muscle, and digestive gland.

Results: Amplified only in DG (amp plot beginning to come up very late for other tissues). No contamination in NTCs.

January 19, 2011
Ceramide pathway protein phylogeny (Sptlc1 and acid sphingomyelinase)
Sptlc1
EST sequence used to design primers overlaps completely with 454 contig 4852, which blasts with high confidence (e-value<10^-30) to Sptlc1 homologs. tlbastx of entire contig shows that the protein coding sequence begins ~bp 1000 (which still includes overlap with original Sptlc1 EST), so trimmed contig and new contig is comprised of bp1000-1879. Did tblastx of trimmed contig. Top hit was with Sptlc1 of Pong abelii (orangutan). Took translated protein sequence from this alignment (i.e. the one used by blast) and used it in alignment (this ends up being the reverse compliment of bp 1045-1821 translated). Other sequences taken from blast results are human (BAF84235.1), mouse (BAE36210.1), frog (NP_001084963.1), zebrafish (P_001018307.1), sea urchin (XP_793539), drosophila (NP_725256.1), C. elegans (NP_001021979.1), sea anemone (XP_001628145.1), and hydra (XP_002161793.1). Sequences were all aligned in ClustalX and alignment was imported into Geneious. Using the PhyML plug-in James-Taylor-Thornton model and 100 bootstraps, a maximum likelihood phylogenetic tree was made for the sequences.


Spingomyelinase (SMase)
C. gigas SMase EST (on which primers were designed) was blasted in tblastx. Protein alignments began at bp 218. The EST was translated in Geneious starting at bp 218 and this protein sequence was entered into protein blast to find homologs. Sequences taken from blast results for alignment are human (EAX07722.1), mouse (NP_598649.1), frog (XP_002939398.1), zebrafish (XP_692822.2), sea urchin (XP_786766.1), drosophila (XP_0013161994.2), C. elegans (NP_505620.3), and a hemichordate (XP_002737983.1). Sequences were aligned and tree was made as described for Sptlc1. (SMase2 is the C.gigas sequence)


January 12, 2011
SMase primer design
EST named "sphingomyelinase" in geneious BLASTs to other sphingomyelinases with e-values around e-40. C. gigas EST accession is CU995168. ORFs extend from ~25 to 743 bp on the reference and primers are designed to fall within this range (total sequence length is 780 bp). Forward sequence: TGGAGCATCGCTTACACAGC; Reverse sequence: ATCACACGGCATCACTTCGG. Product size is 159 bp starting at bp 467 and going to bp 625. See primer database for more details.

January 11, 2011
qPCR to test SMase primers
Did qPCR of 3 blank samples (water only) to find source of contamination seen in previous SMast NTCs on 12.10.2010. volumes of reagents per reaction were: 12.5 uL 2xImmomix, 10.5 uL water, 0.5 uL of each primer, 1.0 uL 50 uM SYTO13. Used qPCR protocol 3stepamp+melt_58annealing_ETS (45 cycles, 58C annealing).
Results: blank samples showed some amplification, but much less than what was seen in NTCs previously.

Made new 10 uM stocks of SMase primers. qPCR comparing old and new 10 uM primer stocks of NTCs (x3), NTCs without primer (x4), and cDNA template (x2). Used qPCR protocol 3stepamp+melt_58annealing_ETS.

Results: product amplification for old and new stock dilutions looked exactly like the NTCs with primers (NTCs without primers did not amplify at all). It appears that the primers do not work well and are probably amplifying primer dimer more than anything else. Need to redesign primers.

December 30, 2010

New notebook!

December 16, 2010
Ceramide
Worked on analysis/manuscript/presentation.

Updated lab notebook with links to qPCR data.

Ceramide sequences
Successful sequences: Fas, Insulin receptor, Lass5, Leptin
Trimmed sequences in Geneious to get rid of poor quality data. enter trimmed sequences into blastx, searching swissprot doing (1) a search with no a priori taxonomy and (2) a search qualifying crassostrea.

December 15, 2010
Ceramide & vibrio exposure: qPCR results
Link to results
Significant differences in expression between control and vibrio-exposed for both PE2 (p=0.00184) and Sptlc1 (p=0.009616).



Also significant differences in expression of Sptlc1 between adult C. gigas tissues:
gill-dig.gland: p=0.0032
muscle-dig.gland: p=0.0284
mantle-gill: p=0.0061
muscle-gill: p=0.00013
muscle-mantle: p=0.007


Vibrio exposure: qPCR of ceramide pathway and nutrition genes
qPCR on pooled control and VE samples; in duplicate with remaining ceramide primers (Fas, Lass5, NGF), Hsp70, Insulin receptor, and leptin receptor.

Results: Link to results. Contamination in NTCs for Hsp70 so did not analyze those results.
Ceramide pathway: Lass5 and NGF are expressed differently between treatments (p=0.015 and p=1.7e-4, respectively). Fas is not differentially expressed, but there are also large standard deviations on the technical replicates.


Nutrition: Both insulin and leptin receptors are expressed at higher levels in the vibrio-exposed oysters (p=0.04 and p=7.4e-4).


December 14, 2010
Ceramide: qPCR
Tissue distribution of Sptlc1 (qPCR previously failed for this gene). Also for pooled control and vibrio exposed adult gill tissues (see below).

Vibrio exposure: qPCR
Pooled control (n=10) and vibrio exposed (n=10) samples reverse transcribed Dec 8, 2010 that had previously been PCR'd separately. 10 uL of each sample into each pool. qPCR done for EF1a, prostaglandin receptor (PE2), and Sptlc1.


December 13, 2010
Ceramide: Follow-up to gene verification (see Dec 6, 2010)
Gene: Lass5 (LAG1 homolog ceramide synthase)
SR returned glucose-regulated protein (Q16956). Alignment with C. gigas sequence for Lass5 (sequence used for primer design) had a lot of gaps - i.e. not a great alignment. Also a lot of gaps when aligned with original P. anubis sequence. Need to see what amplified product looks like before deciding to keep or discard.

Gene: MHC
SR returned myosin heavy chain...oops! wrong MHC? discard this one.

Gene: IL1B
SR returned serine/threonin-protein phosphatase 2A (PP2A). Probably not IL1B, but is involved in apoptosis, so will keep for now.

Gene: Sptlc1
verified as serine palmitoyltransferase 1. Enzyme that catalyzes one of the first steps in ceramide synthesis.

Gene: Sphingomyelinase (SMase)
Verified as acid sphingomyelinase-like phosphodiesterase 3b.

Gene: nerve growth factor B
SR returned cation transport regulator-like protein, or Chac1. Chac1 is a pro-apoptotic component of the unfolded protein response pathway and may mediate some pro-apoptotic effects.

Gene: Fas death receptor
SR returned TNF receptor superfamily, which plays similar role and is related to Fas receptors in ceramide-mediated apoptosis pathway.

December 10, 2010

NOAA OA: qPCR
and
Vibrio exposure: qPCR
qPCR of NOAA OA samples at Spltc1, Lass5, NGF, and Hsp70 (in duplicate). Sptlc1 for Vibrio exposure (duplicate). Used 3StepAmp+Melt_SJW protocol.

Uploaded with Skitch!

NOAA OA: qPCR Results
Link to results
p-values are pairwise comparisons with 380 ppm treatment. ANOVA was non-significant.

Uploaded with Skitch!

Uploaded with Skitch!

Vibrio exposure: results

Notes for next time: If doing qPCR on samples of juveniles or adults that have RNA/cDNA for individuals, try to pool treatments and do qPCR on the pooled cDNA to decrease variability and pull out underlying trends/differences between treatments. Will also save reagents.

NOAA OA: qPCR (SMase)
with optimized protocol: 45 cycles, 58C annealing T

Results (Link): All samples amplified before cut-off of 45 cycles and had the same melt peak, but all NTCs had strong amplification of product so results are not useful.

Ceramide: Sequencing
Prepared DNA and primer plates for sequencing on Monday. Melissa Baird is filling the rest of the plate and will bring it down to the sequencing center.


December 9, 2010
NOAA OA: qPCR
and
Vibrio exposure: qPCR
All 4 NOAA OA samples and n=5 controls and VE for vibrio (C1-5 and VE 1-5). Used EF1a and FAS; all in duplicate.

Results (Link): All negatives were clean and samples amplified.
NOAA OA larvae FAS expression by treatment. There is 0 expression at 2000 ppm. Differences in expression are not statistically significant in an ANOVA comparing expression in treatment. 2 pairwise differences are significant: 380 vs. 2000 ppm (p=0.0113) and 750 vs 2000 ppm (p=0.00145).


Vibrio exposure FAS expression by treatment. Differences in expression are not statistically significant.


Ceramide: Primer optimization
Sptlc1 and SMase
Gradient qPCR (protocol on Friedman machine = ETS_gradient 52-59). Pooled control and VE samples from Vibrio exposure - 14 uL of each - to run one column of control and one of VE for each primer.

Sptlc1 amplified very well (results link). SMase will need qPCR protocol with more cycles, but also amplifies. Both primer sets yielded just one melt curve across annealing temps. 55C annealing temp should work fine with both primer sets, but higher temperatures (~58C) showed a narrower and stronger melt curve for SMase.


December 8, 2010
NOAA OA: reverse transcription
Reverse transcribed gDNA-free RNA samples (n=4). Put 2 ug of RNA (see table below "vibrio exposure") and brought volume up to 17.75 uL with H2O. Added 0.5 uL oligo dT primers and incubated at 70C for 5 min. Put on ice 5 min. Added 5 uL 5x MMLV buffer, 1.25 uL 10 mM dNTPs, and 0.5 uL reverse transcriptase (MMLV) to each sample. Incubated 42C for 1 hr + 95C for 3 min. Diluted samples (25uL) in 225 uL water and stored at -20 in Emma's cDNA Box III.

Vibrio exposure: reverse transcription
Dnased RNA samples from SJW. Followed same procedure as above. "VE" samples (n=10) were exposed to live Vibrio vulnificus and V. parahaemolyticus for 24 hours at 2x10^11 CFU. There are also 10 controls, "C". SJW extracted RNA from gill tissues for all 20 animals on 2.15.2008 and Dnased 3.25.2008.


December 7, 2010
NOAA OA: qPCR results
Link to results
still evidence of contamination in 750E. There is also some contamination in a negative control, almost identical to the amount of gDNA contamination in the sample. Will rePCR all 3 samples this morning to check results.
All samples were clean in qPCR (run jointly with Vt-challenge samples).

Vt-challenge qPCR
Got samples of Vt-challenged adult C. gigas from SJW. Only a very small volume left in the samples, so decreased template volume to 0.5 uL per reaction. Did qPCR of 4 controls and 4 Vt-exposed oysters with FAS primers.

qPCR results didn't look very good and Ct values were very variable (probably due to pipetting variability of 0.5 uL of template). But primers worked on samples. There is more RNA of these samples and I will reverse transcribe it tomorrow.

Ceramide: sequencing
Ran 1.5% agarose gel of sampled PCR'd 12.6.10 (loaded each well with full 25uL volume of PCR product). Used 5 uL of Bioline's Hyperladder I. Cut out bands marked with a green "*" for sequencing. (For Sptlc1, just cut out top band)


December 6, 2010
Ceramide: Sequencing
Prepped DNA and primer plates for sequencing of gel bands cut out 12.3.10.

Table of sequence information for ceramide and nutrition pathway primer design



- sr320 Dec 8, 2010



cPCR based on qPCR protocol of tissue distribution samples to sequence qPCR products.
thermal cycle program (QPCR55): 95C, 3min; 40x 95C 10s, 55C 10s, 72C 30s; 95C 10s.
plate layout - G=gill cDNA, DG=digestive gland, Mu=muscle, Ma=mantle, - = negative control. MHC, SMase, Sptlc1, Lass5, NGF, FAS, IL1B, InsR, and Leptin refer to qPCR primer pairs.

MHC(G)	Lass5 -	InsR (G)
MHC -	NGF (mu)	InsR -
SMase (G)	NGF -	Leptin (G)
SMase (DG)	FAS (Ma)	Leptin -
Smase -	FAS (Mu)
Sptlc1 (G)	FAS -
Sptlc1 -	IL1B (G)
Lass5 (Mu)	IL1B -

NOAA OA: qPCR to test for gDNA
qPCR using 18s primers of samples DNased 12.3.10. Samples are on SJW's plate in column 5 and RNA is diluted 1:20 in water. Layout in col. 5 is:

A	380A
B	750E
C	2000A
D	neg
E	neg
F	x
G	x
H	x

December 3, 2010
NOAA OA, Cg Vt, & ceramide: qPCR
OA - qPCR with 18s to test for gDNA contamination in RNA (see 12.2.10)
Vt - juvenile gill tissue from Vt challenge 3.16.10. Test 4 control & 4 challenged with Hsp70 and Lass5 (and EF1a to normalize). Not done in duplicate.
tissue distribution - test in duplicate of FAS, MHC_q, and Sptlc1. May have contaminated 2nd replicate of FAS gill with DG.

Results (Link): gDNA contamination in OA samples 380A, 750E, and 2000A. Will need to DNase. Hsp70 and Lass5 amplified well in the Vt-challenged juvenile gill tissue. FAS and MHC also amplified well, but Sptlc1 did not amplify. All melt curves look good except for 2nd replicate of FAS DG (well 8C), which will be excluded from all analyses.


all pairwise comparisons between mantle and other tissues expression levels are significant (p=8.46e-4)

all pairwise comparisons of expression levels in the tissues are significant.

Hsp70 for C. gigas juvenile Vt-exposure: p=0.1908.

Lass5 for C. gigas juvenile Vt-exposure: p=0.6139.

NOAA OA: DNase
Rigorous protocol for 380A, 750E and 2000A (see 11.6.09). For volumes see 12.2.10. Dnased samples stored in NOAA OA box at -80C.

Ceramide: sequencing
Gel bands to be sequenced


December 2, 2010
Ceramide: tissue distribution qPCR
Primers = Hsp70, complement receptor, complement C3, defensin

Results link
only Hsp70 amplified (single melt curve). All NTCs were clean.

ANOVA results: muscle-gill p=0.0066.

Ceramide: Gene discovery
PCR for sequencing and prepped primer plate for sequencing. Only PCR'd select tissues that resulted in bands that were picked for sequencing last time.

Primer plate has 7 uL of water and 3 uL of 10uM primer per well.
Loaded entire PCR product onto 1.5% agarose gel. Row 1 is MHC_c gill through Lass 5 negative control. Row 2 is the remaining samples. 25uL of PCR product is in each well of row 1; row 2 wells were smaller so beginning with NGF negative control, 1/2 of each sample is in adjacent wells (tried to put all of NGF muscle in one well and it overflowed). Ran gel at 80V. Bands were cut out and stored at -20C.


NOAA OA: RNA extractions
Extracted RNA using TRI reagent (manufacturer's protocol) from 4 of the 12 samples taken Sept 14, 2010 at 48-hours post-fertilization in the different CO2 treatments. The samples extracted are C from 280ppm, A from 380 ppm, E from 750 ppm, and A from 2000 ppm. For homogenization step, thawed larvae were squished with pestle in 500 uL of TRI reagent 30 times then 500 uL more of TRI was added and samples were inverted a few times before incubation at room temp.
All pellets were visible. RNA was resuspended in 50 uL of water and incubated at 55C for 5 min. Concentration was determined on Nanodrop in duplicate. RNA samples were stored at -80C in NOAA OA September 2010 box. 1 uL of each RNA sample was diluted in 19 uL of water for qPCR test of gDNA contamination (stored at -20 in cDNA box II).


December 1, 2010
Ceramide: qPCR results & stats
p-values are from Tukey's HSD based on aov fit model in R. Only significant values are reported. Error bars are standard deviations with a n=2 for each sample. Expression values are normalized to EF1a (each value is normalized to average within tissue EF1a, n=2).
Leptin amplified in one replicate of the mantle tissue - C(t)=39.97. All genes had a single melt curve.

Insulin Receptor

mantle-dig.gland p=0.022
muscle-mantle p=0.044

Lass5

mantle-dig.gland p=0.00089
mantle-gill p=0.00253
muscle-gill p=0.000473
muscle-mantle p=0.0247

NGF

mantle-gill p=0.0167

November 30, 2010
Ceramide: qPCR
Tissue distribution of genes: Lass5, NGF, Insulin receptor, Leptin, IL1B with EF1a as normalizing gene. (Samples from reverse transcription accomplished October 27, 2010.)

All NTCs were clean and amplification was successful. Results link


November 29, 2010
T/Vt: qPCR
qPCR of samples A, B, D, E, F, G, H, & I for all 4 days (7.13-7.16). See below for details. PCR done on Friedman Lab machine using 3-step amp+melt. File: T-Vt EF1a 11.29.10. qPCR done in duplicate for all samples with 4 NTCs.
Results link
Very little amplification of samples (only ~8 total, a couple per day). Redid qPCR (not in duplicate) but used 8 uL of cDNA template and decreased amount of water per reaction accordingly to 2.5 uL.

Amplification plot for 8 uL qPCR with EF1a primers

C(t) values for samples that successfully amplified in 8 uL template qPCR

The samples in wells F are from chamber G, not E.

November 22, 2010
T/Vt: DNasing
Diluted samples for DNasing as described 11.19.10. Did TURBO's regular DNase protocol: 5 uL buffer + 1 uL enzyme in each sample and incubate at 37C for 30 min. Add 5 uL inactivation buffer and vortex 3x during 2 min incubation. Spin down at 10,000 xg for 1.5 min, transfer supernatant to new tube and store at -80C (in Sarah & Emma's OA/Vt box).
qPCR of DNased samples to test for gDNA contamination. Diluted 1 uL of DNased RNA in 19 uL of water to use as template. Each reaction had 12.5 uL Immomix, 0.5 uL of each primer, 1 uL of 50 uM SYTO13, 6.5 uL water, and 4 uL of template. Loaded samples in following order:

7.14A

7.14D

7.14F

7.14H

7.15E

7.15G

neg

neg

No amplification of any of the samples so can make cDNA. Results link.

Reverse Transcription
RT reactions are based on 2 ug of RNA. The following table outlines how much volume should be used for each sample to equate 2 ug. If a vol > 17.75 uL is required, the maximum of 17.75 uL is used for that reaction (for an amount <2ug).
Samples diluted in 225 uL of water and stored at -20 in Emma's cDNA Box III.

November 19, 2010
T/Vt: Sample prep
qPCR of T/Vt samples taken 7.13, 7.14, and 7.15.10 (previously analyzed samples from 7.16.10). Used 18s primers and amplified diluted RNA (1:20) to test for gDNA contamination. Results link

Some samples had gDNA contamination. Will Dnase Monday - details for DNasing below.


Found concentrations for all samples on Nanodrop (concentrations taken in duplicate then averaged). The chart below is of RNA concentration and 260/280. If 260/280=2.1, the RNA is pure. Anything between 1.8 and 2.1 is considered good quality RNA.



November 13, 2010
Ceramide: Gel of PCR 11.12.10
Made 200 mL 1.5% agarose gel (200 mL 1xTAE + 3 g agarose + 20 uL EtBr). Loaded 10 uL of PCR product in each well (5 uL hyperladder). Ran at 80V for 45 minutes. Cut out bands indicated below and put in cDNA Box II (-20C). Bands are indicated with white arrows and labeled with band name that corresponds to storage tube. Accidentally loaded loading buffer instead of hyperladder on gel, but can still get rough idea of most of the PCR products being the correct size (<200 bp).




November 12, 2010
Ceramide
Received primers for ceramide pathway. Eluted to 100 uM with TE buffer (pH 8.5).

Primer	SRID
FAS F	1019
FAS R	1020
NGF F	1021
NGF R	1022
IL1B F	1023
IL1B R	1024
Lass5 F	1025
Lass5 R	1026

PCR of cDNA (11.11.2010) with new primers. Diluted cDNA in 225uL water; It looked like T.ISO 3 hemolymph sample had evaporated a little. Each reaction has 12.5 uL Apex master mix, 8.5 uL water, and 0.5 uL of each primer (10 uM). 22 uL of master mix and 3 uL of cDNA template in each well. PCR55 program on thermocycler (generic, 55C annealing). Plate layout below.


November 11, 2010
Ceramide/Nutrition: Dnasing
Diluted samples according to volumes for 50 uL (11/8/10). Dnased all samples according to Ambion's TURBO protocol. For both TISO3 and PLY3, followed rigorous protocol for mantle, gill & muscle and followed regular protocol for visceral mass & hemolymph. Regular: added 5 uL buffer + 1 uL Dnase and incubated 30 min at 37C. For rigorous: added 5 uL buffer + 0.5 uL Dnase, incubated 37C for 30 min then added 0.5 uL Dnase and incubated again. At end of incubations added 5 uL inactivation buffer and vortexed 3x over 2 min. Centrifuged at 10000xg for 1.5 minutes and put supernatant in new tube (stored at -80).

qPCR with 18s primers of Dnased RNA to test for gDNA contamination.


Results link

Reverse transcription
Reverse transcribed Dnased RNA to cDNA following protocol from November 6, 2009. Used random primers instead of Oligo dTs.


November 10, 2010
Environmental monitoring
Retrieved PSDs (2) from the Aquarium at 10 am. Water level was higher than when they had been deployed and there were many jellies near the surface. There was a shrimp living in the "anchor" (cement block). Put each PSD in its own ziplock back and transported back to UW on ice (now stored in -20 freezer).
Attachments on long-line hooks had corroded so would need to find a different way of attaching the hooks to the rope for longer deployment. The hooks are supposed to corrode so that they detach from lost/abandoned gear.

November 8, 2010
Ceramide/Nutrition: RNA extractions
Extracted RNA from tissues collected oct. 29, 2010 using TRI reagent. Tissues extracted are for 1 oyster from each treatment (PLY3 & T.ISO 3) and include gill, hemolymph*, visceral mass, mantle & muscle.
Resolubilized RNA pellets (visible pellets in all samples) in water: 50 uL for visceral mass, muscle & hemolymph; 100 uL for gill & mantle. Measured RNA concentrations in triplicate on Nanodrop. Stored samples at -80 in NOAA OA larvae box.


*note of concern: do the hemolymph samples contain gametes?

November 2, 2010
Ceramide pathway: Sequencing
Table of expected sequence sizes vs. sizes of amplified PCR product from gels 10.27.10

Fragments in pink boxes are those that will be sequenced.
Bands to be sequenced with just forward primer: 1-15, 2-3b, 2-10, 1-1b, 1-11a, 3-1b, 3-1c, 3-8
Bands to be sequenced with both primers (>600 bp): 2-3a, 2-4, 2-6, 1-1a, 1-2b, 3-1a

Purified bands in Millipore columns - put bands in gel nebulizer of column and spun down at 5,000xg for 10 min. Put 10 uL of sample in appropriate well (see DNA plate layout below) except for band 1-2b (7 uL purified band + 3 uL water). For primers, put 3 uL of F or R primer + 7 uL water in each well (see below). Gave plates to SJW for sequencing.


October 29, 2010
Nutrition
Terminated algae nutrition experiment. Sampled 3 oysters from each treatment (T.iso and Ply). Took 5 different tissue samples for the 6 oysters: gill, hemolymph, mantle, muscle, digestive gland/visceral mass/gonad. Most of the oysters had developed gonad, which was difficult to distinguish from the visceral mass/DG. Tissues were stored in 1 mL RNAlater at 4C except for hemolymph which was stored in 0.5 mL TRI reagent at 4C. Shucker was cleaned between oysters and dissecting tools were cleaned between tissues in bleach & EtOH.

October 27, 2010
Ceramide pathway
Reverse transcription of DNased RNA samples. Put 16.75 uL water, 1 uL RNA, and 1 uL Oligo dT primers (oops, should have been 0.5 uL) into wells of a plate. Heated at 70C for 5 minutes and put on ice for ~3 minutes. Added 5 uL MMLV buffer, 1.25 uL 10 mM dNTPs and 0.5 uL reverse transcriptase. Heated at 42C 1 hours, 95C 3 min.

Diluted cDNA in 225 uL water. Stored at -20 in cDNA box II.

Primer test with cPCR: test of all new primers (qPCR: leptin, insulin receptor, SMase, Sptlc1, MHC; cPCR: SMase, MHC). For each primer pair, amplified cDNA from gill, mantle, muscle, dig. gland, and hemolymph + 1 negative control. Used Apex master mix: 12.5 uL Apex, 8.5 uL water, 0.5 uL each primer. Thermal profile: 95C 10 min; 95C 30s, 55C 30s, 72C 30s (repeat 40x); 72C 10 min.


Made 1.5% agarose gel (100 mL 1xTAE, 1.5 g agarose, 10 uL EtBr). Loaded gel with hyperladder I (Bioline, see below) in the beginning of both rows (5 uL). Row 1 has samples MHC (c) gill through MHC (q) muscle. Row 2 has samples MHC (q) DG through Sptlc1 negative control.
Ladder

Gel1

Close-up of MHC (c)

Made 50 mL 1.5% agarose gel to run remaining samples. First row on Gel 2 (Row 3) was InsReceptor Gill through Leptin DG. Row 4 was Leptin hemolymph, positive, and negative controls.

Letters at the heads of gel lanes correspond to tissue type from which cDNA was derived: G=gill, Ma=mantle, Mu=muscle,DG=digestive gland, H=hemolymph, +=positive control (Cg control 3 from cDNA box II), - = negative control. Bands that are labeled (i.e. 1-1c) were cut out for sequencing. Bands are in eppie tubes at -20C.
Possible contamination in negative controls for MHC (c) and SMase (c). SMase may be primer-dimer.

Algae counts & feeding: Nutrition
Counted algae and updated spreadsheet. Fed 17.5 mL T.ISO (~165000 cells/mL) and 100 mL PLY (175000 cells/mL).

October 26, 2010
Algae counts & feeding: Nutrition
Counted algae from 10.1-10.12 flasks (300 mL). Fed 15 mL of T.ISO (185,000 cells/mL) and 125 mL/remaining in flask of PLY (200000 cells/mL).

Ceramide pathway
qPCR to test gDNA contamination of RNA extracted 10.20 and to test new primers: leptin, insulin receptor, MHC, sphingomyelinase, sptlc1. All primers were reconstituted today to 100 uM with Tris HCl buffer (pH 8.5). Locations in Primer Box #7 and SRID are as follows:

F2 Cg_MHC_qPCR_F 996 C.gigas 10/26/2010
F3 Cg_MHC_qPCR_R 995 C.gigas 10/26/2010
F4 Cg_SMase-qPCR_F 994 C.gigas 10/26/2010
F5 Cg_SMase-qPCR_R 993 C.gigas 10/26/2010
F6 Cg_Sptlc1-qPCR_F 992 C.gigas 10/26/2010
F7 Cg_Sptlc1-qPCR_R 991 C.gigas 10/26/2010
F8 Cg_MHC_cPCR_F 990 C.gigas 10/26/2010
F9 Cg_MHC_cPCR_R 989 C.gigas 10/26/2010
G1 Cg_SMase-cPCR_F 987 C.gigas 10/26/2010
G2 Cg_SMase-cPCR_R 986 C.gigas 10/26/2010
G3 CgInsulinR-F 985 C.gigas 10/26/2010
G4 CgInsulinR-R 984 C.gigas 10/26/2010
G5 CgLeptin-F 983 C.gigas 10/26/2010
G6 CgLeptin-R 982 C.gigas 10/26/2010


qPCR on DNased RNA (see 10.25.10) was done with 18s primers with duplicates of samples. RNA was diluted 1:20 in water before added to the reaction.
qPCR to test primers insulin, leptin, MHC, SMase, and Sptlc1 was done on cDNA from OADev (samples 380 B1 and 840 A1, in duplicate).

Results: All new qPCR primers worked in at least one sample except for SMase. There was no amplification of the RNA samples, meaning there is no evidence of gDNA contamination and samples can be reverse transcribed. The gDNA control amplified with the 18s primers. There was no evidence of contamination in any of the NTCs.



October 25, 2010
Ceramide pathway
Used nanodrop to find RNA concentrations from extractions 10.20.10. Took concentrations in triplicate of each sample - gill, dig. gland, mantle, muscle, hemolymph. Calculated number of uL needed for 10 ug of RNA and brought up to 50 uL with water. Hemolymph was the only sample that required a volume >50uL for 10 ug so used entire sample.

DNased RNA samples, did rigorous protocol for all except did regular for hemolymph since RNA concentration was so low. See March 18, 2010 for details on rigorous protocol. For rigorous added 0.5 uL DNase + 5 uL 10x buffer to samples and incubated at 37C for 30 min; added additional 0.5 uL DNase and incubated another 30 minutes. Regular protocol: added 1 uL DNase + 5 uL buffer and incubated at 37 C for 30 min.
After incubations, added 5 uL inactivation buffer and vortexed 3 x over 2 minutes. Spun at 10,000xg for 1.5 min and put supernatant in new tube. Stored at -80.

Algae counts & feeding: Nutrition
Karissa counted algae from 10.19 flasks (300 mL). Fed 30 mL of T.ISO (210000 cells/mL) and 90 mL of PLY (171000 cells/mL).
Made 2L new media from water Zac autoclaved last week. Seeded new flasks of PLY and T.ISO.


October 24, 2010
Algae counts & feeding: Nutrition
Counted algae from feeder flask for T.ISO and from 300 mL 10.19 for PLY. Significant numbers of dead algae cells (most were still alive) in T.ISO so after feeding discarded remaining algae. Fed ~360,000 cells /mL of T.ISO and 340,000 cells/mL of PLY (T.ISO probably an overestimate given number of dead algal cells in culture).

October 22, 2010
Algae counts & feeding: Nutrition
Counted algae - did not add any EtOH. Updated counts are in spreadsheet. Fed oysters ~11 mL of T.ISO (170000 cells/mL) and the rest of the PLY (~40 mL, 196000 cells/mL).
Before feeding changed water in tanks.

October 21, 2010
Algae counts & feeding: Nutrition
Counted algae. Added 50 uL of 75% EtOH to 1 mL of algae from feeding flasks. Still not enough EtOH to completely stop swimming, but algae were slower. Oysters were fed 15 mL T.ISO and 77 mL PLY.

October 20, 2010
Ceramide pathway
Extracted RNA from tissues collected yesterday using TRI reagent. All pellets were resuspended in 100 uL water, except hemolymph was resuspended in 50 uL. Resuspension was aided by incubation at 50C for ~5 minutes, samples were then lightly vortexed and stored at -80 in NOAA Sept 2010 box.

Algae counts & feeding: Nutrition
Counted algae from 300 mL flasks 10/1-10/12 because did not see other flasks which had been taken out of the hood. Added 10 uL 75% EtOH to 1 mL of algae to slow algae movement. Took 2 aliquots from the 1 mL and counted 6 squares on hemacytometer. This did not have much of an effect on the algae. Oysters were fed 20 mL T.ISO and 155 mL PLY, ~170000 cells/mL each.
Fed the trash can oysters 10 mL SD1800.

Biomonitoring
Deployed 2 PSDs at the Aquarium (POCIS). PSDs were attached to a rope using long-line clips. The rope was weighted with a large cinder block (PSDs were ~5-6' above the block). The block & PSDs were lowered into the water until the block touched bottom and then the top of the rope was tied off to secure vertical suspension of the PSDs in the water column. PSDs will be deployed for 3 weeks.

October 19,2010
Algae counts & feeding: Nutrition
Counted algae (see 10.13) and updated spread sheet. Fed oysters 14 mL T.ISO and 47 mL PLY (~170000 cells/mL each).
White/grayish debris in bottom of tanks is probably feces - looked under 'scope and they were dense and solid.
Also under scope found larvae from the tanks - surprise barnacle larvae!!

Cleaned out tanks by emptying water, rinsing twice with dechlorinated water and refilling with new seawater until oysters covered. Fed oysters after cleaned tanks.

Ceramide pathway
Dissected oyster from yesterday. Tissues for RNA extraction (gill, mantle, muscle, digestive gland, and hemolymph) were put in 0.5 mL RNAlater at 4C; duplicates of all tissues except hemolymph were frozen immediately at -80C. The frozen tissues are in the C. gigas Larvae NOAA OA September 2010 box.

October 18, 2010
Algae counts & feeding: Nutrition
Counted algae (see 10.13) and updated spread sheet. Fed oysters 20 mL TISO and 142 mL PLY (2x normal feeding because missed feeding this weekend, ~340,000 cells/mL). Oysters were all sightly agape. Weird white stuff on bottom of PLY treatment tank - will investigate tomorrow. Will also change water in both tanks tomorrow.

Environmental monitoring
Picked up 2 PSDs from Irv Shultz (PNNL). Irv has membranes mounted inside steamers (cooking appliance) and held closed with zip ties. This would save $355 per site ($1065 total).

Ceramide signaling pathway
Picked up an oyster from Taylor shellfish to dissect for various tissues and test ceramide pathway primers. Put oyster in tank with saltwater.

October 15, 2010
Algae counts & feeding: Nutrition
Counted algae as outlined 10.13.10 and updated spread sheet. Fed oysters 15 mL T.ISO and 95 mL PLY (~1.7*10^5 cells/mL). Oysters in both treatments were slightly agape.
Fed trashcan oysters 10 mL SD1800.
Oysters will not be fed 10.16.10.


October 14, 2010
Algae counts & feeding: Nutrition
Counted algae as outlined 10.13.10 and updated spread sheet. There was more cells/uL of T.ISO today but not of PLY. Fed the oysters 25 mL of T.ISO (1.66x10^5 cells/mL) and 115 mL of PLY (same # cells/mL).
Oysters in T.ISO treatment are mostly closed and barnacles are inactive. This is in stark contrast to the oysters in the PLY treatment where all barnacles are active and all oysters are slightly agape.
Fed trashcan oysters 10 mL SD1800.
Received leptin pathway primers (2 pairs) but did not elute.

October 13, 2010
Algae counts & set-up: Nutrition
Swirled algae flasks so well-mixed. Took aliquots from both algaes, Isochrysis (T. ISO) and tetraselmis (PLY). Counted 2 ~15 uL aliquots from each algae type on hemacytometer. Counts were for number of algae cells in 6 different squares as defined by the pink square (below). T.ISO cells were much smaller than PLY cells. Ongoing algae counts can be found in spreadsheet here.

Uploaded with Skitch!

Put oysters (collected at Big Beef Creek) in 2 separate rectangular experimental tanks (n=4 for T.ISO and n=5 for PLY). Each tank has a small pump to create water flow. Fed the PLY treatment 100 mL of algae and the T.ISO treatment got 25 mL of algae. Oysters in trash can were fed 10 mL of shellfish diet 1800.

October 11, 2010
Primer design: Ceramide Signalling Pathway
Designed primers for sequencing and qPCR for genes in the ceramide pathway. Known vertebrate sequences for the genes and their C. gigas homologues were aligned in Geneious. In some cases (MHC, Lass5, and SMase) consensus sequences for C. gigas were created based on multiple overlapping ESTs. For MHC and SMase, there is not a published EST for the entire ORF so primers were designed based on the consensus sequences to include the entire ORF. QPCR primers were designed for MHC, SMase, and Sptlc1.

Uploaded with Skitch!

yellow arrows designate open reading frames in the oyster sequence (1) and the Bombyx mori homologue (2).

October 7, 2010
Bioinformatics: Ceramide Signalling Pathway
Read more papers on ceramide (see My Delicious, "ceramide" bookmark).
Got NCBI sequences from top BLAST hits (10.6.10). Blasted these top hits against NCBI nucleotide and est databases for cross-reference purposes. Will have to determine e-value cut-off for determining if gene is really in oyster ceramide pathway. Sequences will be the basis for primer design.


October 6, 2010
Bioinformatics: Ceramide Signalling Pathway__
Compiled list of genes in the pathway based on Ballou et al. 1996: Ceramide signalling and the immune response. Reference sequences in organisms with the genes in the pathway that are published on NCBI were compiled (see spreadsheet). For each gene, sequences were entered into blastall (wet genes) with the following settings: tblastx (nucleotide query transl./transl. nuc. db); protein db "nr"; nucleotide db "cgigas...Sigenae"; tabulated output. (All other settings default).




September 8, 2010
OA at NWFSC
Experimental plan with Shallin and Elene. Day 0 = Monday, September 13.
pCO2 treatments (6 replicates): 280, 380, 740 ppm. 3 replicates at 2000 ppm just for development data.
Day 0, 9/13: fertilization; check development at 0.5, 2, and 5 hours. Data: demographics, RNA. Systems are static.
Dat 1, 9/14: Switch to flow-through. Data: Demographics, RNA
Day 2, 9/15: terminate 2000 ppm at 48 hours. Clean jars. Data: demographics, DNA.
Day 4, 9/17: Clean jars. Data: demographics, DNA, RNA.
Day 7, 9/20: Clean jars. Data: demographics, DNA, RNA.
Day 10, 9/23: Clean jars. Data: demographics, DNA, RNA.
Day 14, 9/27: Place shell fragments for settlement in bottom of jars. Clean jars. Data: demographics, DNA, RNA.
Day 17, 9/30: Clean jars. Data: demographics, DNA, RNA.
Day 21, 10/4: Clean jars. Data: demographics, DNA, RNA.


Sperm motility at NWFSC
Plan for preliminary sperm motility experiment with A. Bruner and A. Dittman. Will check cell densities of C. gigas sperm on 9/9 and make standard curve. Video capture 9/10.

OADev
Repeat of qPCR 9/3 on Friedman lab qPCR thermalcycler. See 9/3 for details.

September 7, 2010
OADev
qPCR from 9.3.10 had funky fluorescence. Repeat PCR (same sheet as 9.3).

Uploaded with plasq's Skitch!

Still weird fluorescence.
qPCR to check SYTO 13 (50 uM) made 8.31.10. Made new SYTO stock - 1 uL 5mM SYTO 13 in 99 uL DMSO. qPCR in replicate with master mixes made from 2 different SYTO dilutions.

fluorescence is a problem with the qPCR machine.

OA at NWFSC
1 pm: dropped off oysters collected at Big Beef Creek on 9.6. Oysters are at ~20C in flowing water.

September 6, 2010
Prep for spawning
Collected ~23 adult C. gigas from Big Beef Creek. Tide was high (~1:30 pm). Opened a few oysters to check ripeness before collecting. Oysters on river side of bridge above tide were barely ripe. More ripeness in subtidal oysters under bridge and along the beach in the bay. Oysters were collected from these 2 locations and transported back to UW on ice. Once back at SAFS, put oysters in seawater tank with air and a pump to create water flow.


September 3, 2010
OADev
Exported qPCR data from 9/1 and 9/2 with manual threshold of 0.011. Too much variation to tell if differences are significant or not. Samples that need to be rerun (due to low efficiency or failed amplification):
EF1: 840 C2
CytP450: 380A2, 380 A1, 840 C1


qPCR of rerun samples and all samples for duplicate. Also included Hsp70 (CM primers).

Uploaded with plasq's Skitch!

T/Vt
Samples inoculated with Vt at 25C: A,G,D,H
Samples inoculated with Vt at 12C: J,K,C,L
Controls (unclear which are at which T): B,E,F,I,M,N,O,P - but we think the 25C controls are F,E,B,I and 12C controls are O,M,N,P.
Exported qPCR data from 9/1 & 9/2 with manual threshold of 0.019. Samples that need to be rerun are:
EF1: A,D,H,P
cjunk: A,D,P,F,G,I
NfkB: all

September 2, 2010
OADev
qPCR of 380 A1, A2, B1 and 840 A1, B1, C1, C2 (cDNA). Genes = BPI, CytP450, Prx6, and Hsp70.

Uploaded with plasq's Skitch!

Results: BPI did not amplify - need to check paper for published annealing temp, etc.; CytP450 & Prx6 were fine; Hsp70 had a terrible melt curve. SW says that the primer set is bad in general and gave me newly designed primers (from Christina Miller).
T/Vt
Reverse transcription (see 11/6/09) of 7.16 J & K.
qPCR of T/Vt 7.16 cDNA with c-jun kinase and NfKB (also EF1a for J & K). Tested new Hsps70 primers (from CM) with some unknown cDNA.

Uploaded with plasq's Skitch!

September 1, 2010
OADev & T/Vt
DNase (standard protocol) of 380 C1 and 7.16 J & K.
Reverse transcription (MMLV see 11/6/09) of clean DNased samples from 8/30 and 8/31 (n=21). Samples in welled plated in following order:

7.16 L	840 C1	7.16 G
7.16 B	7.16 N	840 B1
7.16 F	840 C2	7.16 C
7.16 P	840 A1	380 B1
7.16 H	7.16 M	7.16 I
7.16 A	380 A1
7.16 E	7.16 O
7.16 D	380 A2

Diluted all cDNA in 225 uL water. Transferred to 1.5 mL tubes & stored at -20.

qPCR of cDNA (gene = EF1a) and of DNased RNA (diluted 1:20) 380C1 and 7.16 J & K (gene = 18s).

Still contamination in 380C1, but J & K are clean.

Made sample database of all RNA, cDNA and samples.

August 31, 2010
OADev & T/Vt
qPCR results from 8.30: Some samples were clean and some had gDNA contamination. Clean samples: 380 A1, 380 A2, 840 C2, 7.16 A, D, H, O and P. All negatives were clean and gDNA controls amplified more than most of the RNA samples. Chose samples with the highest gDNA levels, diluted them 1:20 in nanopure water and did qPCR with 18s primers. Samples picked for re-amp. were: 380 C1, 7.16 B, F, I, and N.

Uploaded with plasq's Skitch!

Still evidence of contamination in all samples tested at 1:20 dilution. Re-DNase (standard protocol, 1 uL DNase, 5 uL buffer, incubate 37C for 30 min) all samples that showed evidence of gDNA contamination in qPCR from 8.30.
qPCR of re-DNased samples with 18s primers.

All samples clean except for 380 C1. Will re-DNase 380C1 and 7.16 J &K, which were missed yesterday.

August 30, 2010
OADev & T/Vt
Extracted RNA from OADev samples using Tri Reagent. Extracted 4 from each CO2 treatment. For 380 ppm: A1, B1, C1, A2. For 840 ppm: A1, B1, C1, C2. 380 ppm C1 spilled ~1/2 volume during vortexing after chloroform addition.

Found RNA concentrations using Nanodrop for extracted OAdev sample & 16 RNA samples (extracted at FHL) from T/Vt trial 7.16. Did concentrations of 3 aliquots of 1.5 uL from each sample.

Uploaded with plasq's Skitch!

3 concentrations were averaged unless one was anomalous, then is was discarded from calculations. From averaged concentration, determined how many uL would be needed for 10 ug. If >50 uL, then used entire sample for DNasing (all RNA samples are 50 uL); if <50 uL, then made up difference with DEPC-treated H2O.
Dnased samples using Ambion's rigorous protocol (details March 18, 2010).

qPCR of all RNA samples with 18s primers to test for gDNA contamination (4 negative controls, 2 positive controls of C. gigas DNA).

Uploaded with plasq's Skitch!

August 27-30, 2010
LD50: C. gigas larvae + V. tubiashii
Counted larvae in the am to determine live vs dead. Same protocol as 8.26. Did 4x on 8.26-28, switched to 10x on 8.29 & 8.30. Data here.
In a number of the samples, fewer larvae were swimming as of 8.27 (see data for details). Ciliates first observed on 8.30 in chambers C, N, and B. Larvae were not counted in K & D on 8.30 because they had all been dead since 8.27.


August 26, 2010
LD50: C. gigas larvae + V. tubiashii
Got ~1x10^6 Cg larvae from Taylor yesterday (8/25). larvae were spawned on Monday (8/23). Divided larvae equally between 10 treatment chambers (1.5 L). Chambers were filled with seawater and aerated.
10 am today inoculated 8 treatment chambers with Vt. Inoculation at 4 concentrations in duplicate: 10^6, 10^5, 10^4, and 10^3 CFU/mL. 2 chambers left as controls. Before inoculation, homogenized larvae in water column with "plunger" and sampled 10 mL. Took 3 aliquots from those 10 mL and put in 3 wells of a depression slide. Counted larvae in 3 fields of view at 4x. Determined live vs. dead (xls "LD 50 mortality data"). Larvae appeared healthy and most were swimming actively. They had bivalved shells and velums.


July 27, 2010
IMPORTANT NOTE
Until this week Lillian was not cleaning water collection jars used to sample microbe. communities outside the hatchery.

July 13, 2010
Cg Larvae - Vt & T trial 2
8 am
Set one tote to 12C and the other to 25 C using chiller & heater, respectively. Later in the day Elene inoculated 4 chambers in each tote.
9 pm
Fed larvae. Divided ~ 125 mL T.iso/Plya between 16 chambers.

July 12, 2010
Cg Larvae - Vt & T trial 2
New larvae from Taylor. 9-day old, ~ 2 million. Divided between 16 larval chambers in 2 separate totes.

July 9, 2010
Cg Larvae - Vt trial 1
8:25 am
neutral red staining of larvae from each chamber
50 Vt colonies at 10^-3
4 pm
ended experiment. Sampled all remaining larvae from remaining chambers.
T=20C
salinity = 31 ppt
pH <8

July 8, 2010
Cg Larvae - Vt trial 1
7: 40 am
started 6 hour Vt incubation. Inoculated new media ( 25 mL of 0.25% tryptone and seawater) with 100 uL of 24 hour Vt culture from 7/7. Placed culture on rocker in incubator (26C).
Counted colonies from yesterday's Vt used for inoculating larvae. Counted colonies on both 10^-3 concentration plates - n=109 & 74. According to equation CFU/mL = # colonies * 1/0.1 * dilution this 183 * 10^6 CFU/mL.

8:10 am
Started neutral red incubation of 50 mL larvae + 50 uL 1% neutral red.

11 am
Emptied, rinsed and replaced banjo filters in all chambers. Sampled larvae. There were very few larvae left in H so sampled all and now only have 7 chambers for remaining part of trial.
T: 23C
salinity: 30 ppt
pH: ~8

1:40 pm
boiled 4 mL of Vt for 1 hour to heat kill. Made 5 serial dilutions: 1 mL Vt in 9 mL sterile water. Spread 2 plates each for last 3 dilutions - 10^-3, -4, and -5. Put in 25C incubator overnight.
2:10 pm
Neutral red microscopy: photographed and measured larvae from all 8 chambers.
4 pm
Inoculated treatment chambers (A, B, D & E) and put algae (T. iso + Plya, 50 mL between 7 containers) in all chambers.


July 7, 2010
Cg Larvae - Vt trial 1
Temp: 21C
salinity: 31 ppt
pH: ~8
Repeated steps from 7/6 - neutral red, sampling, feeding, inoculating.
Ciliates observed in larvae from E.

July 6, 2010
Cg Larvae - Vt trial 1
10:45 am
Got larvae from Taylor shellfish 7/5/10. Larvae were spawned 6/30.
salinity 31 ppt, T 20C, pH <8. Water flow is on for one hour every other hour.
11:20 am
Put 50 mL of SW + larvae from each chamber into small glass vial and added 50 uL neutral red. Swirled gently and let sit 6 hours.
4:00 pm
Emptied and cleaned all larval chambers. Refilled with fresh SW. Sampled larvae for RNA (1 per chamber). Replaced all non-stopper chambers with stoppered ones and replaced all banjo filters with clean ones. Fed larvae mix of T.iso and Plya (50 mL divided between 8 chambers).
5-5:30 pm
Inoculated treatment chambers (A,B,D & E) with 100 uL heat-killed Vt (prepped by ED).
Measured and assessed mortality of neutral red-dyed larvae from this am. Took 40 uL aliquots from each dyed sample and measured all larvae positioned well for measuring. If n<10 in the 40 uL aliquot, did a 2nd or 3rd aliquot. Noticed ciliate in chambers B & D.

July 2, 2010
Cg Larvae
Emptied and cleaned all larvae chambers. Sampled for RNA and microscopy as described below. Today was end of trial so cleaned out all chambers. Sizes recorded in spreadsheet. Live swimming larvae visible in all chambers except F.

June 30, 2010
Cg Larvae

Emptied and cleaned all larvae chambers. Replaced the banjo filters with new, clean 70 micron filters. Took one sample from each chamber to put in RNAlater and then a few larvae for microscopy. Stored the RNA samples in 500 uL RNAlater. Refilled all chambers with fresh seawater.

Microscopy: Looked at all larvae under dissecting scope to assess if there were any still alive. All chambers except D & I had live larvae swimming around. Put 50 uL from each sample on depression slide and photographed under compound scope + camera to measure with SPOT. Measured larvae from all chambers except D & F because there were no larve in the aliquot. The only larvae measured were ones with a dorsal or ventral view that were providing a view of a circle (posterior or anterior views did not provide clear measurements). Measurements were taken along the longitudinal and latitudinal axes of the dorsal/ventral side of the larva.

June 28, 2010
Cg Larvae
made 1 L f/2 media for algae culture. See recipe 5/28.

Emptied and cleaned all larvae chambers. Sampled RNA larvae for gene expression (in 500 uL RNAlater) and microscopy. For microscopy, just took samples from chambers A & F. Measured subset of these using microscope. Summary statistics (data are in spreadsheet CO2 Cg larvae sizes start 062310), measurements are in microns and letters indicate larval chamber:

mean A	100.4615385	91.23076923
max A	107	101
min A	87	78
sd A	4.875369808	7.037445632
n A	13
mean F	101.25	96.75
max F	112	109
min F	84	83
sd F	8.091802811	7.967262562
n F	12

Under dissecting scope, larvae were observed swimming, although fewer were obviously active.

pH in treatment tank ~6, in control <8.

There appeared to be very few larvae left in chamber D but all chambers still had larvae.

Fed larvae Ply 429, 50 mL split between 8 chambers.

June 26, 2010
Cg Larvae
Drained and rinsed larvae from all chambers. Took samples for gene expression analysis and stored in 500 uL RNAlater. Looked at larvae from D & E under dissection microscope. Larvae are still alive and swimming vigorously. Chamber E seems to have many more larvae than the other chambers although good concentrations of larvae apparent in all chambers.
Returned larvae to respective chambers and fed all chambers a mix of T.iso and Ply429 (50 mL between 8 chambers).

June 25, 2010
Cg Larvae
12:30 pm
pH in treatment tank <7, pH in control ~8 (measured with litmus paper)
Changed pump cycle to 1 hour on/one hour off.

2:00 pm
Put mixture of T.iso & Ply 429 in all chambers (dived 50 mL between 8 chambers).


June 24, 2010
Cg larvae
Got new larvae last night (6/23) from Taylor Shellfish. 5 day-old c. gigas. Put in chambers with new water around 5 pm with water flow and air bubbling. No co2 treatment.

Got new seawater from the aquarium today.

pH and pH probe: the pH probe is not properly calibrated to low pHs (it seems to be broken/missing a piece). It accurately measures the pH 7 standard, but not the 4. It is indicating that the seawater is at pH<7. After testing with litmus paper, it seems that the SW is probably at a pH of about 7. Turned down the pH probe so that it was about 0.2 units below what it thinks the seawater is so that CO2 would bubble into the treatment tank. There are now treatment and control chambers (same as before).

air: turned off air delivery to all chambers because the air flow was too strong.

water: put pumps on a timer so that they are on for one hour and off for 2. this is to make sure that the larval chambers do not overflow.

larvae sampling: filtered each larvae chamber on 64 micron mesh and rinsed in 2 buckets of water. Took sample for RNA analysis (0.5 mL RNAlater) and subsampled from 4 chambers for microscopy. Replaced larvae in chambers after rinsing and sampling with new water. Rinsed all chambers before putting larvae back.

Uploaded with plasq's Skitch!

June 19, 2010
Cg Larvae
Emptied and cleaned all larvae chambers. Took 1 sample from each chamber and stored in 0.5 mL RNAlater at 4C. pH for treatment was at 7.5. Also took a few larvae to observe in microscopy (from screen). There seemed to be fewer larvae in each chamber.
Microscopy: a number of larvae were still alive and swimming vigorously. Under the dissecting scope, I did not see any evidence of ciliates.
Larvae were put back in proper containers. We are low on seawater so I switched the system to recirculation, meaning that there are no longer treatment and control groups.

Uploaded with plasq's Skitch!

June 18, 2010
Cg Larvae
6:20 pm, pH in treatment water 7.5. Treatment chambers are A, B, E, G. Controls are H, D, F, I.
Sampled 2 mL of water from each chamber. No larvae were apparent in any of the aliquots. Will filter out all chambers tomorrow and thoroughly assess state of larvae.

June 17, 2010
Cg Larvae
12:00 pm: lowered pH for water going to treatment chambers by about 0.4 pH units (to about 7.5).
Made 900 mL F/2 media: 900 mL sterile seawater (from 5/28) 118.8 uL each Procul A & B (new bottles).
Split algae cultures into new media: F/2 for T-iso and Ply429, F/2 + silicates for TW.

Cleaned all larvae in 2 washes seawater. While larvae on filter, removed >1000 and put in RNAlater for extraction. Took 2 samples from each chamber, stored at 4C. Before larvae put back in chambers, rinsed thoroughly with dechlorinated water and refilled with fresh seawater. Put some Ply429 in each of the chambers.
At 8:00 pm the pH in the treatment water was down to about 7.3.
In a number of the chambers with rubber stoppers (vs. resin) there were larvae stuck between the stopper and the side of the neck of the bottle.

June 16, 2010
Cg Larvae
about 8:30 pm. New larvae from Taylor (9 day-olds). ~89 larvae per mL in 1000 mL. Put 137.5 mL of larvae in each of 8 chambers - about 12,237 in 1.5 L. Chambers were filled with fresh seawater and attached to water and air supplies.

June 11, 2010
Larval Chamber set-up
Filtered out and washed all larvae. Put aside in 1 L beaker with seawater.
Looked for ciliates in samples of water from tote and from water barrel, but found none.
Dismantled and washed all parts of larval chamber set-up.
New water set up and air flow with brand-new tubing. Holes in PVC done with 7/32 drill bit.

Uploaded with plasq's Skitch!

June 10, 2010
Cg Larvae
Counts per mL (based on 3 mL)
A: 1
B: 16
H: 4
F: 1
E: 0
I: 1
G: 6
When present, most larvae were alive and many were swimming (veligers). Almost all larvae in chamber G were dead and there was one larger shell (2x size of others).

Uploaded with plasq's Skitch!

RNA Extraction
Extracted RNA from larvae collected 6.9.10. Spun down tubes of larvae + RNAlater (5000xg for 5 minutes) and used pipette to remove larvae from bottom of tube. Extracted with TRI following manufacturer's protocol. Resuspended pellets in 50 uL water. All samples except F had visible pellets of RNA. Analyzed concentrations of RNA on Nanodrop. Stored samples at -80. (Letters indicate which larval chamber sample was taken from.)

Uploaded with plasq's Skitch!

Where did all the larvae go?
Emptied chamber A onto a 48 micron screen to capture all larvae in water column. Placed in bath of seawater, removed stopper and rinsed larvae stuck to stopper into petri dish. Rinsed & refilled A, replacing larvae on screen. Looked at stopper larvae under microscope and noticed that there were a number of ciliates in with the larvae (some larvae were still alive, but the ciliates were viciously attacking them). Looked at some of the algae from the hatchery under the scope but did not see ciliates.

Uploaded with plasq's Skitch!

Emptied all other chambers, one at a time, onto a screen. Rinsed them twice in seawater on the screen. Emptied chamber completely, rinsed well, and refilled with fresh water. Replaced the water in the rest of the system as well. This process will need to be repeated daily to ensure expulsion of all ciliates.

June 9, 2010
Cg Larvae
Counted larvae in all chambers. Took 3 mL from each water column and counted # larvae per mL. Larvae were mostly alive and active except in chambers H & F where a large number were dead. Counts are in counts per mL, followed by average for the 3 mL and then estimated # per chamber.
A: 21, 34, 52; avg. 35.7; total 53,500
B: 41, 15, 63; avg. 39.7; total 59,500
H: 10, 3, 12; avg. 8.3; total 12,500
F: 23, 25, 22; avg. 23.3; total 35,000
E: 0,0,1; avg. 0.3; total 450
I: 1, 4 (only 1 alive), 0; avg. 1.7; total 2,500
G: 22, 7, 25; avg. 18; total 27,000

Uploaded with plasq's Skitch!

Uploaded with plasq's Skitch!

Sample ~1000 larvae from each chamber. Volumes will be as follows:
A: 28 mL
B: 25 mL
H: 120 mL
F: 43 mL
G: 55.5 mL
Volumes were filtered on a 48 micron mesh and larvae were removed from filter with a transfer pipette and immediately placed in ~0.5 mL RNAlater. Stored at 4C.

Changed water in system. Fed each chamber ~5 mL algae.

June 8, 2010

Went to Taylor Hatchery in Quilcene.
Microbial Community Sampling (with Joth)
~11:00 am, Dabob Bay
Sample depth: ~2m
Used horizontal sampler to collect seawater from depth. Filled 2 plastic bottles (rinsed with seawater). Filtered 300 mL from each of these plastic bottles and fixed with 3 mL fixative. Folded papers and put in 2 mL tubes. Transported back to Seattle on ice and stored at -20C.

Also brought back 1 gallon algae mix for feeding larvae and 2 50 mL tubes with 8 day old C. gigas larvae (~488,000 larvae).

Counted larvae in chambers from last Thursday. There were none visible from the water column of any of the chambers. All the larvae had sunk to the bottom and were on/around the stoppers. Emptied out all old larvae and rinsed chambers.

Put new larvae in chambers. The following volume of evenly suspended larvae were put in each indicated chamber.
A 100 mL
B 400 mL
D 100 mL
E 100 mL
F 100 mL
G 100 mL
H 100 mL
I 100 mL
This turns out to be 48,800 for the 100 mL chambers and 195,200 for B - or 33 larvae per mL and 130 larvae per mL, respectively.
Put about 5 mL of algae mix in each chamber.

June 7, 2010
Partial water change in larval system. - sr320 Jun 7, 2010

June 4, 2010
Chamber E was emptied and F density reduced.
Chambers A & B received 3 ml T-iso each (1 week old)
Chambers C& H received 10 ml T-iso each (1 week old)
Aquarium water postponed till next week.
No feeding during weekend given supply. Will feed on Monday.
Next week will also gear up for CO2 trials. Need to speak to Elene on how to preserve samples for pH measurements.
- sr320 Jun 4, 2010

June 3, 2010
Cg Larvae
Notes on Feeding
Ponis et al. 2003:
in 2 L beakers (1.8 L seawater)
D-hinge larvae at 5/mL
feed 3x per week (when change sw) with 10^5 algae cells/mL

Ponis et al. 2006
in 2 L beakers 5 D-hinge larvae/mL
fed every other day, 50 cells/uL first week then 100 cells/uL

Quantifying Algal cells
Took 20 uL from each algae culture flask. Looked at cells under scope - they were moving too rapidly to count accurately. Added ~45 uL Lugol's Iodine to each 20 uL aliquot (will multiply counts by 2.25 to make up for the dilution). Average number of cells per uL from each flask, with x2.25 correction, are as follows (counted on a hemacytometer):
A1. Ply 429 5/28 w/foil top: 2.25
A2. Ply 429 6/1: 2.25
A3. Ply 429 5/28 w/ cotton: 3
B1. TW 5/28 w/ foil: 6.25
B2. TW 5/28 w/ cotton: 2.25
C1. T-iso 5/28 w/ foil: 218
C2. T-iso 5/28 w/ cotton: 422
C3. T-iso 6/1: 15

Aim to feed larvae 100 cells per uL of volume at which they are held. If feed equal amounts of each algae, will feed 33 cells/uL of each component. With 1.5 L (or 1.5 x 10^6 uL) in each chamber, need to feed ~4.95 x 10^7 cells of each algal component.
Based on the cell counts above, the volumes from each of the flask to feed 4.95E7 cells would be:
A1. 22 L
A2. 22 L
A3. 16.5 L
B1. 7.9 L
B2. 22 L
C1. 227 mL
C2. 117 mL
C3. 3.3 L

Brent brought back new C. gigas larvae from Taylor Shellfish in Quilcene. They are indicated at being 10 days old and when observed under microscope appear to be early veliger stage. Poured larvae into 1 L beaker of seawater. Plunged to evenly suspend larvae and sampled 10 mL. Counted 1 quadrant (1/4) of larvae in each mL (counts are estimates, not exact). The 10 1/4 counts are: 150, 60, 120, 50, 500, 50, 30, 45. This averages out to be about 380,400 larvae total or about 380 larvae per mL.
There are 10 larvae per mL in chambers A & B.
50 larvae per mL in chambers C & H.
The remaining larvae (approximately 527 mL worth, or 100,197 larvae) were evenly distributed between chambers E & F. This works out to be about 67 larvae per mL.
All chambers are outfitted with air stones and new water delivered via drippers at 2 L/hour.

June 2, 2010
Cg Larvae
Replaced pump in larval chamber set-up. Measured pump rate (without drippers) at 420 mL/minute.
Turned all drippers in chambers the other way and they are no longer having clogging problems. Looks like they were upside down before.

May 29, 2010
Fed Mac's oysters (top & bottom tanks) ~9am.
Changed water in larval tank. Counted 5 mL larvae from chambers A, B and C. There were no larvae until the last mL (corresponding to water taken from the bottom of the chamber) for any of the samples. In A there were 32 larvae, 4 were alive and 2 were 2x the size of the others (dead). In B there were 8 larvae, 2 alive. In 7 there were 17 larvae, 1 alive.

Extracted RNA from larvae samples collected 5.25.10 with TRI reagent following manufacturer's protcol. Homogenized larvae (even when none apparently visible) with pestle in TRI reagent.

May 27, 2010
Algal starter cultures
Sterilized 2 L of seawater in glass bottles (just sterilization cycle in autoclave).
Sterilized varied flasks & graduated cylinders for growing algae on full sterilization through exhaust cycle.

To make 1 L of pro-culture for algal starter cultures:
Procul A & B = Kent Marine Pro-cultures A and B
10 mL Procul A + 10 mL Procul B for 20 gallons of water
1 L = 0.264 gallons
0.264 gallons * (10 mL/20 gallons) = .132 mL = 132 uL of Procul A & B for 1 L seawater

Adding silicates:
1 gallon Procul A + 1 gallon Procul B makes 7,680 gallons culture water
Add silicates at 20 g per 1,000 gallons of culture water
0.132 mL of Procul A + Procul B makes 38.425 gallons of culture water
Need to add 0.7685 g of silicates

Sterilized all equipment needed to make culture media in germicidal hood for 15 minutes. Made 1 L of regular culture media (Procul A & B) and 1 L of regular media + silicates. Media are made in sterile bottles, labeled, and at 4C (behind my bench).

May 26, 2010
Cg Larvae
Changed water in system.
Larvae counts for remaining chambers. Took 5 mL aliquots from each chamber, 1 mL in each well of 12-well plate. Counts are followed by observations
A: 1 (dead), 3 (1 dead), 0, 38, 51
For the wells containing n=38 and n=51 only a few larvae were swimming in each well. In the n=38 well, 2 larvae were twice the size as the others (these 2 were alive, but not swimming so couldn't determine stage). All swimming larvae were veligers.

B: 1, 0, 0, 1 (swimming), 2 (1 swimming)
veligers

C: 0, 0, 0, 0, 7
At least one larva was alive. None were swimming.

May 25, 2010
Cg Larvae
Larvae counts for chambers - took 2 aliquots of 1 mL each and counted larvae under dissecting scope.
A: n=2 & 4
B: n= 1 & 1
C: n=1 & 0
E: 0
Z: 0
All larvae were swimming actively (veliger).
Noticed that there were what looked like larvae floating on the surface of the water and on the bottom of the holding tank. Took 1 mL aliquots of surface and bottom water. There were no larvae in the top sample but >50 from the bottom.
Determined that larvae were escaping from Z & E. Filtered out all the water in these chambers through a 60 micron mesh and transferred to RNAlater. Took chambers into lab for repairs.

May 24, 2010
Cg Larvae: RNA & DNA Extraction
RNA extraction : Following manufacturer's protocol for TRI Reagent.
DNA extraction: manufacturer's protocol (details below)
1. Upon separation of sample into aqueous (RNA), inter-, and phenol phases, remove aqueous phase for RNA extraction.
2. Add 0.3 mL 100% EtOH to interphase + phenol phase and mix by inversion
3. store at RT 2-3 minutes
4. centrifuge 2000xg, 5 min, 4C
5. remove supernatant
6. wash DNA pellet 2 times. Each time wash with 1 mL 0.1 M trisodium citrate in 10% EtOH and store at RT for 30 minutes, periodically mixing. Centrifuge at 2000 xg for 5 min, 4-25C.
7. Suspend in 1.5-2 mL 75% EtOH.
8.store 10-20 min RT, mix
9. centrifuge 2000 xg 5 minutes, 4-25 C
10. remove EtOH and dry at RT
11. dissolve pellet in 0.3-0.6 mL 8mM NaOH
12. spin 12,000 xg 10 min
13. Remove the supernatant = DNA

Reagents needed: 100% EtOH, 75% EtOH, 0.1 M trisodium citrate in 10% EtOH, 8 mM NaOH
To make 0.1 M trisodium citrate in 10% EtOH:
2.941 g sodium citrate
90 mL H2O
10 mL 100% EtOH

The samples from 5.21.10 were the only ones with RNA and DNA pellets.

Uploaded with plasq's Skitch!

May 23, 2010
Cg Larvae
Changed water in system.
Sampled the following volumes (in mL) from the specified larval chambers -
A & B: 5, 10, 20
C & E: 1, 2, 4
Z: 0.5, 1, 2
The volumes correspond to approximately n=50, 100, & 200 larvae, respectively.

Observations and counts of 1 mL of larvae from each of the larval chambers -
A: n=9; actively swimming, veligers
B: 0
C: n=4; actively swimming, veligers
E: 0
Z: n=1; actively swimming, veligers

Spun down all samples at 1200 rpm for 5 min (20 C). Removed supernatant and stored at -80C.

May 22, 2010
Cg Larvae
Changed water in system.

May 21, 2010
Cg Larvae
Changed water in system. Joth brought in new larvae. Suspended in 1 L seawater, stirred well and aliquoted 1 mL 3 times into plate for counting larvae. Drew quadrants on the bottom of the wells. Counted larvae in 2 quadrants for each of the three aliquots.
Per quadrant counts:
I: 40, 52, 66
II: 70, 45, 90
Per well counts (quadrant * 4):
I: 160, 208, 284
II: 280, 180, 360
average number of larvae per mL = 245
Total larvae = 245,000

Counts from chamber C (sampled 10 mL larvae + water): 180 larvae, 18 larvae/mL

For new larvae, want 2 chambers with 10 larvae/mL and 2 with 50 larvae/mL. 10 larvae per mL would = 15,000 larvae in the chamber (~1.5 L), which is 16.3 mL of the 245,000 larvae in 1 L. 50 larvae per mL would be 75,000 larvae per chamber, which is 81.5 mL of the 1 L. After aliquoting the larvae to their respective chambers, there is 804.4 mL of larvae + seawater left in the 1 L beaker. (Between each aliquot, plunged strainer up & down in beaker to suspend larvae homogeneously.) This 804.4 mL is about 197,000 larvae, or about 131 larvae per mL. Larval chambers with concentrations below:
Chambers A & B: 10 larvae/mL
Chambers C & E: 50 larvae/mL
Chamber D: Elene's larvae (was chamber C)
Foil-covered chamber (=chamber Z): 131 larvae/mL
From chamber Z took 20 mL and 40 mL of larvae (this is about 26,000 and 52,000 larvae respectively). Spun down at 12000 rpm for 5 minutes (20C). Some larvae still in suspension after spinning down, but still removed most of seawater and froze remaining larvae at -80C.

May 19, 2010
Cg Larvae
Changed water in system. Last night Elene put many new larvae in chamber C. Counts today yielded about 55 live larvae in 10 mL for chamber C and almost not larvae in chambers B & D. New larvae arriving tomorrow as well.
Empty out chambers B & D. Prepare chambers A, B, & D for larvae tomorrow.

Sampling protocol for determining # of larvae needed to do usable RNA extraction.
Every other day, sample 50, 100, and 200 larvae (10, 20, and 40 mL) from each chamber. Filter and preserve in RNAlater for RNA & DNA extraction.

May 18, 2010
Cg Larvae
Changed water in system. Sampled 10mL from B and 9 mL from D.
B 1/4
D 1/4

May 18, 2010
Cg Larvae
Changed water in system. Realized that pump for drip into chambers was not plugged in and so was not providing fresh water to chambers - plugged in pump. Sampled 10 mL from chambers B & D.
B 7/26
D 24/57

May 17, 2010
Cg Larvae
Changed water in system. Sampled 10 mL from chambers B & D.
B 5/20
D 6/8

May 16, 2010
Cg Larvae
Changed water in system. Sampled 10 mL from chambers B & D.
B 9/18
D 0

May 15, 2010
Cg Larvae
Changed water in system. Sampled 10 mL from chambers B & D. Counts are #live/total.

B 3/7
D 15/27

May 14, 2010
Cg Larvae
Suspect that did not transfer most of the larvae from holding chamber, that they were probably all on the very bottom. Put water drip & airstone in this larval chamber (now "D") under assumption that it contains larvae.
Similarly to yesterday, took 10 mL from larval chambers B & D. For B sample, found only 1 dead larva. For D sample found 14 live & 58 dead.

May 13, 2010
Cg Larvae
Brent got ~100 mL (~5000?) Cg larvae from Taylor yesterday. Put in larval chambers last night with bubbling air and water drip (chambers B & C). System is currently closed (i.e. not flow-through).
Mortality estimates:
Took 1 mL from top of larval chambers and then 2 aliquots of 1 mL from bottom of chambers B & C. Under dissecting scope, counted larvae alive & dead.
Counts are #live/total larvae in aliquot

larval chamber	1	2	3
B	0	0	0
C	0	0/8	1/4

Note: results may be inaccurate. During next mortality estimates, realized that ciliary action within/under larvae was present on most and was not noticed in previous observations.
Took 10 mL from each larval chamber (started pipetting at bottom and then dragged pipette up through larval chamber so sampled entire water column). Aliquoted 1 mL into 10 wells of plate.

larval chamber	1	2	3	4	5	6	7	8	9	10
B	1/1	0	0	0	0	0	0	0	0	3/3
C	0	0	0	0	0	0	0	0	0	0

Larval morphology: larvae are brown and transluscent (lighter brown inside). When moving have fringing beating cilia. When stationary, can see ciliary movement through larval body.
Look similar to this


April 30, 2010
Cg metal exposure
Diluted cDNA 1:10 by adding 180 uL RNase-free water to each 20 uL sample.
qPCR: EF1 (duplicate), metallothionein IV/MTIV, prostaglandin receptor/PE2.

Uploaded with plasq's Skitch!

April 28, 2010
Cg metal exposure
DNase RNA
Definite gDNA contamination in all RNA samples. DNase samples using Ambion's TURBO DNA-free rigorous protocol (see 3.18.10).

Uploaded with plasq's Skitch!

qPCR of DNased RNA with 18s primers
Exact same PCR as 4.27.10. See sheet below for plate layout & mix recipe.
Carry-over (or is it some contamination?) very much reduced. Data not meant for publication, so not going to worry about it.
RNA -> cDNA
Reverse transcription of DNased RNA following protocol 11.6.09.

April 27, 2010
Cg metal exposure
RNA Extraction
Extracted RNA from gill tissues from both trials. Tissue IDs for 4.21.10 end date are: Cu1, Cu2, Cu3, C1, C2, C3. Tissue IDs for 4.26.10 end date are: Cu2.1, C2.1, C2.2, C2.3. RNA Extractions with Tri Reagent according to manufacturer's protocol. Resuspended in 50 uL RNAse-free H2O, heated for 5 min at 55C to dissolve. Concentrations of RNA measured on Nanodrop for each of the samples.

Uploaded with plasq's Skitch!

RNA -> cDNA
Made cDNA from all RNA samples following protocol 11.6.09. Stored remaining RNA at -80 in C. gigas 2010 Box 1.
plate layout:

	1	2
A	Cu1	C2.2
B	Cu2	C2.3
C	Cu3
D	Cu2.1
E	C1
F	C2
G	C3
H	C2.1

Cu = copper trial
C = control
_2.# = 2nd trial


Well that was silly, I forgot to check for gDNA carry-over. Maybe I did a perfect extraction and I have clean RNA.
qPCR of RNA with 18s primers


April 26, 2010
Cg metal exposure
9:30 am
End of trial
Treatment: 2 mortalities, 1 live oyster at end of trial, silty green sediment at bottom of tank. Opened dead oysters for observation, took photos of one (below). Sampled gill tissue of live oyster (Cu2.1 4.26.10) and preserved in RNAlater. Shells of all 3 were bright green.
Control: All 3 still alive, feces at bottom of tank. Sampled gill tissues of all 3 oysters and preserved in RNAlater.

Uploaded with plasq's Skitch!

April 24, 2010
Cg metal exposure
11:30 am
Changed water in both tanks
Treatment: murky green sediment at bottom of tank (silty). 1 mortality (stored at -20). To new tank water, added 5 mL of 0.4 g CuN2O6 dissolved in 20 mL sterile seawater. Also added 5 mL Shellfish Diet 1800.
Control: Feces at bottom of tank. To new tank added 5 mL sterile seawater and shellfish diet. No mortalities.

April 23, 2010
Cg metal exposure
10:00 am
Treatment: oysters still alive.

April 22, 2010
Cg metal exposure
10:40 am
used juvenile Cg controls from previous experiment (n=7).
Gave both treatment (n=4) and control (n=3) groups new seawater (1.5 L) and 5 mL Shellfish Diet 1800. Both tanks are aerated with air stones.
Treatment: To tank added 5 mL of 0.4 g CuN2O6 dissolved in 20 mL sterile seawater.
Control: Added 5 mL sterile seawater.

April 21, 2010
Cg metal exposure
3:00 pm: end of treatment.
Treatment: Removed oysters from treatment tank. 3 more mortalities (n=3 for sampling). Stored morts at -20. Opened 3 others that appeared to be alive and sampled gill tissue (stored in ~1.5 mL RNAlater, 4C).
Control: Removed 3 oysters from control tank. Renewed water (no food) for remaining 7 (live!) oysters. Sampled controls as above with pictures of dissection. Saved sacrificed oysters for further analysis and comparison with morts from treatment at -20.

Uploaded with plasq's Skitch!

April 20, 2010
Cg metal exposure
10:20 am
Changed water in both treatment and control tanks. Gave both tanks 10 mL shellfish diet. Renewed metal in treatment tank, but at half of previous dosage (4.18.10 had diluted 0.39 g CuN2O6 in 20 mL sterile seawater, so added just 10 mL of solution to treatment and 10 mL sterile seawater to control).
Observations control: water cleared of food added 4.18 with many dark feces at bottom. All alive.
Observations treatment: water still murky from food, but some feces (many fewer than control) at bottom. 3 more mortalities (open shells). All shells still bright green. Stored morts at -20.

April 18, 2010
Cg metal exposure
5:00 pm
Changed water in both treatment and control tanks. Gave both tanks 10 mL new shellfish diet. Did not renew metal in treatment tank.
Observations control: Water was clear and dark feces present at bottom of tank. All alive.
Treatment tank: Water bluish and murky green with white sediment at the bottom. Oyster shells bright green. No apparent feces in tank. One mortality. Chose to suspend treatment for 2 days and then begin again with smaller dose. Stored mort at -20 for further dissection and analysis.

April 16, 2010
Cg metal exposure
3:00 pm: Put juvenile Cg (n=10 each treatment) in 1.5 L seawater. Oysters are from North Bay,WA collected 4.3.10. Aerated water with airstones.
To treatment tank (on right) added 1.4 uM copper (II) nitrate hydrate from Sigma Aldrich (0.394 g). 0.787 uM was shown to be sublethal environmentally realistic dose (Macey et al. 1999). CIIN was dissolved in 27.5 mL sterile seawater.
To control tank added 27.5 mL sterile seawater.
To both tanks added 7.5 mL Shellfish Diet 1800.
Challenges will last 1 week. Water will be changed and metals replenished every second day.

April 15, 2010
V. tubiashii culture
Colony growth on plate from 4.14.10. Starter culture of 5 mL LB + 1% NaCL, 37 C 250 rpm at 8:45 am.
4:15 pm: starter culture is cloudy (bacterial growth). Inoculated ~100 mL 1x LB + 1%NaCl with starter culture and put in incubator at 37C, 250 rpm.

April 14, 2010
Make LB plates for Vt growth: Added 3 g bactoagar to 200 mL 1xLB + 1% NaCl. Mixed and put in autoclave, only sterilization cycle.
Plated LB. Started culture of V. tubiashii on one of the plates to incubate overnight at 37C. (4:40 pm)

April 13, 2010
V. tubiashii culture
2:20 pm: no growth in yesterday's starter culture.

April 12, 2010
V. tubiashii culture
7:15 am: culture is still only a very little cloudy so will continue incubation.
5:45 pm: no growth in 100 mL culture. Re-inoculated starter culture (5 mL) with Vt from 4.8.10, left at 37 C 250 rpm.

April 11, 2010
V. tubiashii culture
Culture from 4.9.10 sat at RT over the weekend. At 8:00 am put at 4C. At 3:45 pm inoculated ~100 mL LB+1% NaCl. Incubated at 37 C 250 rpm.

April 9, 2010
V. tubiashii culture
7:30 am: 5 mL culture no growth. Inoculated 5 mL LB + 1% NaCl, incubated at 37C 250 rpm.
2:45 pm: no growth in new culture. Inoculated ~2mL LB + 1% NaCl to see if less volume = more movement for cells = better growth (37 C, 250 rpm). Both cultures will be in incubator overnight.

Oyster feeding
Water was clear! Oysters ate! Lots of feces in bottom of tank. Replaced oysters in appropriate bags and put in large container. Renewed water & food in small tanks and put in Willapa Bay oysters (11 am).

April 8 2010
V. tubiashii culture
culture did not grow. Restreaked new LB plate + 1% NaCl with stock of V. tubiashii from -80 (frozen stocks box, bottom shelf, green eppie tube). Incubated plate at 37 C. Also started working culture in ~ 5mL LB medium + 1% NaCl at 37 C, 250 rpm around 10:30 am.
5:00 pm: Vt had grown on plate. Removed from incubator, sealed with parafilm, into fridge 4C.

Oyster feeding
Put 5 mL Shellfish Diet 1800 in 50 mL falcon tube. Gradually added 45 mL sterile seawater, mixing between additions to make 10% Shellfish Diet.
Filled 2 small plastic tanks with ~ 2L seawater (the seawater that the oysters are kept in). In one tank, put n=21 juvenile Cg from NB (51x35, Ro15, from Dec. 2009) and ~10 mL 10% Shellfish Diet. In second tank, similar set-up but oysters were collected from North Bay 4.3.10. Water appears to be light green in both tanks (11 am).

April 7, 2010
V. tubiashii culture
Made 200 mL 1x LB + 1% NaCl: 40 mL 5x LB lab stock, 160 mL nanopure H2O, 2 g NaCl. Autoclaved without exhaust/dry cycle.
Swiped Vt from plate grown 3.12.10 with sterile wand and swirled in ~100 mL LB + NaCL in flask. Put in incubator, 37C, 250 rpm overnight.

April 6, 2010
FISH 310
Ran 10 uL PCR products from 4.5.10 on 1.5% agarose gel + 10 uL EtBr.

April 5, 2010
Vt-exposed juvenile Cg
Determined concentration of samples on Nanodrop.

Uploaded with plasq's Skitch!

Normalized cDNA concentrations to 68.6 ng/uL.
qPCR of normalized cDNA for EF1.

Uploaded with plasq's Skitch!

FISH 310
PCR of student DNA with both Abalone and olympia oyster primers (positive and negative controls). Used Apex PCR mix: 12.5 uL Apex, 8.5 uL H20, 0.5 uL each primer; 22 uL master mix + 3 uL DNA.

Uploaded with plasq's Skitch!

March 30, 2010
FISH 310 prep: species ID
Prepared 100 mL 10 % chelex (100 mL nanopure water + 10 g chelex). Transferred to 3 falcon tubes.
Used 20 uL pipette to aliquot 5 uL of EtOH + 1-4 larvae (verified presence of larvae in aliquot visually) into eppie tube. Only testing larvae B,C, & D since there are limited A & E. Left caps open to dry at RT in hood.
Extracted DNA with chelex: aliquoted 300 uL 10% chelex into each tube w/ larvae. Heated at 100C for 20 minutes. Spun down and removed supernatant (DNA).
Prepped master mix for abalone primer set & olympia oyster primer set according to lab worksheet - 19 uL MM, 1 uL template. PCR with each primer set for unknown DNA B,C,D, neg. chelex, neg. PCR and either positive abalone or oly depending on primer set. PCR'd at thermal profile in worksheet.

Prepared 1.5% agarose gel with EtBr. Ran 10 uL PCR product on gel with 100 bp ladder. Only positive amplification was positive controls for both species.

March 29, 2010
qPCR of Vt-exposed juvenile oysters: complement C3 & complement receptor


March 26, 2010
Primer reconstitution
Reconstituted the following primers to 100 uM in TE buffer, pH = 8.0 (all for C. gigas): mannose binding, complement C3, properdin, complement receptor, ficolin, defensin, proline-rich polypeptide (prp), hemocyte defensin 2 (defh2), and BPI. All stored in primer box #6.

qPCR of new primers with cDNA.

primers that failed: BPI, Prp, Defensin
primers that amplified successfully: complement C3, complement receptor, mannose binding, properdin, ficolin.
hemocyte defensin 2 warrants further testing.
Below are the quantitation curves of the successful primers.


March 25, 2010
qPCR of Vt-exposed juvenile Cg: EF1 & prostaglandin receptor (PE2)

Uploaded with plasq's Skitch!

March 23, 2010
qPCR of Vt-exposed juvenile Cg: IkB & IL-17

Uploaded with plasq's Skitch!

Uploaded with plasq's Skitch!

Note of caution: These are non-normalized expression values. Normalization to come...

March 22, 2010
RNA -> cDNA
Followed reverse transcription protocol on 11.6.09.

qPCR of cDNA with Hsp70, IkB, and IL-17. Negative and positive (gDNA) controls.

Uploaded with plasq's Skitch!

Uploaded with plasq's Skitch!

Uploaded with plasq's Skitch!

March 19, 2010
Vt-exposed oyster reDNase
Evidence of gDNA contamination from qPCR

Uploaded with plasq's Skitch!

DNase with regular Ambion protocol. Used DNased RNA from 3.18.10. Added 1 uL DNase and 5 uL 10x TURBO buffer. Incubated at 37C for 30 minutes.
Added 5 uL deactivation buffer & incubated at RT mixing 3 times. Spun at 10000xg for 1.5 minutes. Removed supernatant to clean tube and stored at -80.

qPCR of 1:20 dilution newly-DNased RNA with 18s primers (identical layout and protocol to 3.18.10).

Uploaded with plasq's Skitch!

March 18, 2010
Vt-exposed oyster DNase
Followed manufacturer's protocol (Ambion) for TURBO DNA-free, following the rigorous protocol. Made 10 ug in 50 uL dilutions of RNA.

Uploaded with plasq's Skitch!

Added 0.5 uL DNase and 5 uL 10x TURBO buffer. Incubated at 37C for 30 minutes. Added 0.5 uL DNase and incubated 30 min at 37C.
Added 5 uL DNase inactivation buffer to each sample, incubated for 2 min at RT and mixed 3x during incubation. Spun at 10000 xg for 1.5 minutes. Removed supernatant (RNA) to clean tube, stored at -80.

Make cDNA
Followed protocol on 11.6.09.

qPCR
qPCR of DNased RNA with 18s primers to test for gDNA contamination.

March 16, 2010
Vt-exposed oyster RNA extraction
Extracted all 16 gill samples (Cg+Vt 1-8 and CgC 1-8) with TRI Reagent following manufacturer's protocol. Resuspended dry RNA pellets in 100 uL ultrapure-superclean-RNase free water and heated at 50C for 5 minutes to put in solution. Measured concentration of samples on Nanodrop.

Uploaded with plasq's Skitch!

Samples stored at -80C.

March 15, 2010
Oyster challenges
Removed Vt from incubator at 1:50 pm. Took ~1 mL of bacteria + broth and spun down in centrifuge at max speed to make blank for measuring absorbance.
Measured absorbance of cultured on Nanodrop at 620 nm to determine CFUs.
CFU calculations are based on growth curve for V. tubiashii acquired from R. Elston. The CFU vs. absorbance trendline is described by the equation: y = 3E9x-3E8.

	ND absorbance at 620 nm	CFU
	0.159	1.77E8
	0.147	1.41E8
	0.150	1.50E8
average	0.152	1.56E8

For challenge, desired CFU is 10^4 per mL in 1.5 L seawater = 1.5E7 CFU total.
This translates to 96.2 uL of bacteria culture in a 1.5 L seawater tank.

Aliquoted 96.2 uL of bacteria in culture to a 1.5 mL eppie tube. Spun down for 2 minutes at RT, 5000 rpm. Removed supernatant (broth) and resuspended in 100 uL sterile seawater. Verification under microscope that vibrios were still alive (moving).

Took 1.5 L of seawater from oyster holding tank for each experimental set-up (5.5 L tanks) and put 8 juvenile oysters in each tank (Willapa Bay, 51x35). Provided air flow to each tank. In control group, aliquoted 100 uL sterile seawater. In experimental challenge aliquoted the resuspended vibrio. (3:30 pm). Challenge will last 3 hours.

6:30 pm. Brought experimental tanks of oysters into lab. Sampled gill tissue of all 16 oysters and put in labeled tubes of RNAlater. Sampled Vt-exposed oysters first. Between each oyster, all tools were sterilized first in 10% bleach and then in 95% EtOH + autoclaved sand. Oysters were shucked with a shucker and gill tissue was removed with forceps and scissors. Sample tubes were topped off with RNAlater (each tube contains 1+ mL RNAlater). Oyster shells seemed brittle and most oysters were pretty easy to open. After all samples were taken, tubes were put at 4C overnight. Stored at -80C.


March 14, 2010
V. tubiashii culture
In hood, swiped bacteria from plate with sterile scraper and swirled in ~55 mL LB broth + 1% NaCl in Erlenmeyer flask. Covered with foil and put in incubator at 250 rpm, 37C at 10:45 am.

March 12, 2010
V. tubiashii plating
Pre-made LB plate with 1% NaCl - incubate at RT for 15 minutes.
Turn on UV light and blower in hood for 15 minutes.
Vt stock from -80C freezer, kept on ice. Using sterile spreader, dipped spreader tip in frozen Vt and spread on plate. Incubate plate upside down at 37C until end of day (visible bacteria growth) and SW transferred to 4C.

February 16, 2010
PCR of O. orca cDNA
Cox2 did not amplify in the qPCR, but hsp6 amplified in all samples (same product size and only one product peak).
Regular PCR of 3 samples (...) to verify amplicon size (primers were designed for hsp6 that amplifies at 523 bp in T. truncatus and at 350 bp in gray whale).
template: 3 uL cDNA (1:10)

Reagent	volx1	volx5
2xapex buffer	12.5 uL	62.5 uL
H2O	8.5	42.5
Pf	0.5	2.5
Pr	0.5	2.5

February 15, 2010
O. orca Reverse Transcription & qPCR
Followed RT protocol from 11.6.09, but used 10 uL of RNA and 6.75 uL of H2O with 0.5 uL oligo dTs. After final incubation, diluted entire cDNA 1:10 in 225 uL of H2O (stored in eppie tubes at -20C).

for qPCR, used Cetacea consensus primers for cox2 and hsp6 (primer box #4, F8 & F9, G1 & G2). Made dilutions to 10 uM and prepped master mix.

February 10, 2010
O. orca RNA: Bioanalyzer 2100
Based on concentrations from nanodrop 2.9.10, made 10 uL dilutions of all RNA samples to 5 ng/uL in DEPC water.

Uploaded with plasq's Skitch!

Ran Pico chip on Agilent Bioanalyzer with herring RNA (sample 1) as control. In order, samples 2 through 11, ran RNA from L87, K13, L60, L57, L82, Luna, J19, L53, K27, L2.
Results show probable RNA degradation of most of the biopsy samples, except for L53.

Uploaded with plasq's Skitch!

February 9, 2010
RNA Extraction of Archival O. orca Blubber

All samples are biopsies of blubber except for Luna and L60, which are samples taken from necropsies. L60 is a skin sample, Luna is a blubber sample.

Animal	Weight of Biopsy (g)	Fraction biopsy used	Weight tissue extracted
Luna	0.1	1	0.1
L60	0.1	1	0.1
L57	0.09	1/2	0.045
J19	0.1	1/2	0.05
L73	0.09	1/2	0.045
L87	0.05	1/4	0.0125
K13	0.07	1/4	0.0175
L53	0.1	1/4	0.025
L2	0.08	1/2	0.04
L82	0.05	1/2	0.025
L67	0.08	1/4	0.02
K27	0.06	1/4	0.015

Extracted each sample with 1 mL TRI Reagent according to manufacturer's protocol. RNA pellets were resuspended in 50 uL DEPC water and incubated at 55 degrees C for 5 minutes. Samples were then mixed and nanodropped. Concentrations

January 20, 2010
qPCR of IkB: CO2 challenged juvenile oysters
All 16 samples in duplicate. gDNA for standard curve in dilutions 1:10, 100, 1000, 10000.

Uploaded with plasq's Skitch!

January 19, 2010
Primer test qPCR
qPCR of new primer dilutions for matrilin, beta tubulin, and chaperonin. Included EF1 and Prx6 as controls. 2 samples with template and 4 negative controls. Still evidence of contamination in the new primer dilutions and in EF1 (not Prx6). Discarded working stocks of EF1, matrilin, beta tub., and chaperonin.

Uploaded with plasq's Skitch!

Test qPCR of IkB (with Prx6 as positive control).

Uploaded with plasq's Skitch!

January 13, 2010
Contamination test of new primers, qPCR
Before removing template from the freezer, made master mixes for primer sets EF1 (control), chaperonin, matrilin, and beta tubulin. 3 blanks for each primer were sealed. Template removed from freezer and 4 more wells (2 + template, 2 negative) were prepared for each set.
PCR protocol as follows

Uploaded with plasq's Skitch!

January 12, 2010
New primers qPCR
Tested new primers with pooled cDNA (1 uL template per reaction). 2 wells of template, 4 wells of negative controls per primer set.

Uploaded with plasq's Skitch!

Still evidence of contamination. Did another qPCR, new template and included Hsp70. Also included 2 wells in each primer column with just 25 uL of water.

Uploaded with plasq's Skitch!

January 11, 2010
New primers
Ordered new primers for Cg, Beta tubulin, matrilin, and chaperonin.
Made pH 8.5 TE Buffer:
1 mL Tris HCl 0.5M, pH = 6.8
0.1 mL 0.5 M EDTA
48.9 mL nanopure H2O
Brought pH up to 8.5 with 1N NaOH.

Reconstituted dried primers to 100 uM using volumes based on 10Xnm.

January 4, 2010
Contamination check
Still evidence of contamination in PCR from 1.1.10. Ran PCR products on 1.5% agarose gel. Clear evidence of contamination for both primer sets on gel as well.
Did qPCR of blanks withe primers Hsp70, Prx6, chaperonin, and matrilin.

Uploaded with plasq's Skitch!

January 1, 2010
qPCR optimization of matrilin and chaperonin primers
temperature gradient of 54-66 degrees C. Used leftover pooled cDNA from differential display as template. Protocol outlined here

Uploaded with plasq's Skitch!

.

December 31, 2009
Contamination check
Regular PCR, no template. Primers: beta tubulin, matrilin, chaperonin, Hsp70, and Prx6. Each reaction is 25 uL.

Reagent	volx1	volx5
2xApexBuffer	12.5 uL	62.5
H2O	11.5	57.5
Pf	0.5	2.5
Pr	0.5	2.5

Ran PCR program CLNY under SBR menu on thermocycler. Plate layout below.

PCR with same primers, but added genomic DNA template (dilutions 1:100 and 1:1000). Used same master mix recipe, but 2 uL template per reaction and 9.5 uL water. Plate layout
Ran PCR products on 1.5% agarose gel + EtBr at 100 V for ~45 minutes.


December 30, 2009
Contamination check
SW's PCR with primers was clean. I redid the qPCR with beta tubulin, matrilin, and chaperonin with and without template and with standards. Protocol

Uploaded with plasq's Skitch!

.
Contamination still universal in negative controls.

December 29, 2009
Contamination check
previous qPCR's with DD gene discovery primers showed evidence of contamination. Suspect contamination was in water, including water in which primer dilutions were made. Made new 10 uM primer stocks with new water and did qPCR without template to compare old and new 10 uM primer dilutions for matrilin, beta tubulin, chaperonin, and TGF-b.
PCR protocols

Uploaded with plasq's Skitch!

Still evidence of contamination in the PCR. SW ran primers chaperonin, B tubulin, and matrilin with his master mix.

December 17, 2009
qPCR with Gene Discovery Primers: CO2 challenged juvenile oysters
Designed primers based on DD products (sequenced clones). From BLAST, 4 putative genes were identified: Beta tubulin, TGF-b, matrilin, and chaperonin.
qPCR of B-tub. and matrilin as outlined

Uploaded with plasq's Skitch!

.
Used standard curve of gDNA (0.445 ng/uL) at dilutions 1:10, 1:100, 1:1000, and 1:10000. In ng: 0.178-0.000178.
qPCR of chaperonin and TGF-b as outlined

Uploaded with plasq's Skitch!

.

December 3, 2009
Cloning of DD products: CO2 challenged juvenile oysters
PCR of restreaked colonies
Master Mix (x35)
2xApex buffer 875 uL
water 805 uL
Pf 35 uL
Pr 35 uL
Aliquoted 50 uL of MM into plate wells. Touched sterile plastic wand to restreaked colonies and set in MM. Swirled wands in MM before removing. Program CLNY in SBR directory.

Uploaded with plasq's Skitch!

Made 1.2% agarose gel and ran 20 uL of colony PCR product at 100V for ~30 minutes.

Uploaded with plasq's Skitch!

Based on gel band sizes, did Qiagen minipreps for sequencing of the following samples (PS#-colony#): 10-4, 10-5, 10-6, 12a-1, 12a-3, 12a-5, 9-1, 9-4, 10-4, 10-5, 10-6, 12b-1, 12b-4, 18-1, 18-3, 38-2.
Followed Qiagen MinPrep protocol to extract DNA from chosen cultured colonies.
Poured ~1.5 mL of each LB+colony into minicentrifuge tubes. Spun at max speed, 2 min. Discarded supernatant and poured in 1.5 mL more, spun, and decanted (white pellet on bottom).
Resuspended pelleted bacteria in 250 uL Buffer P1 via vortexgin.
Added 250 uL Buffer P2 and mixed by inverting 4 times.
Added 350 uL Buffer N3 and immediately mixed by inverting 4 times.
Transferred supernatant to QIAprep spin column and centrifuged at 13000xg for 1 min. Washed column with 750 uL Buffer PE and spun at max speed for 1 min. Discarded flow through and spun additional minute at max speed.
Put column in new eppie tube, added 30 uL Buffer EB. Let incubate at RT for 1 minute, then spun for 1 min.
Put 10 uL of eluted DNA into plate to send off for sequencing.

December 2, 2009
Cloning of DD products: CO2 challenged juvenile oysters
Plates from 12.1.09 had few and faint colonies. Leave to incubate at 37C to allow for more colony growth.
Grid a plate with 8 squares for PS#10 colonies and 8 squares for PS#12 (200 bp) and 2 squares for a negative control (dark blue colony) from each.
Prepped master mix:

Reagent	volx1	volx18
2xApex buffer	25 uL	450 uL
water	23 uL	414 uL
Pf	1 uL	18 uL
Pr	1 uL	18 uL

Aliquoted 50 uL master mix into wells of partial 96-well plate.
Using sterile plastic wand, picked colonies, streaked them in the appropriate plate grid, and then placed wand (tip first) in corresponding MM-filled well in plate.

Well	Sample	vol/color	Well	Sample	vol/color
A1	10-1	50/W	A2	12-1	50/W
B1	10-2	50/W	B2	12-2	50/B
C1	10-3	50/W	C2	12-3	50/W
D1	10-4	50/W	D2	12-4	100/W
E1	10-5	100/W	E2	12-5	100/B
F1	10-6	100/W	F2	12-6	100/B
G1	10-7	100/W	G2	12-7	100/B
H1	10-8	100/W	H2	12-8	100/W

Vol/color indicates the volume with which the plate was streaked (50 or 100 uL) and the color of the picked colony (white or light blue).
Ran PCR on thermocycler, SBR directory, CLNY program.
Thermal profile:
94C, 8:00
40 cycles: 94C, 45s; 50C 1:00; 72C, 1:30
72C, 10:00

Made 1.2% agarose gel (1.2 g agar, 100 mL 1xTAE, 10 uL EtBr). Loaded 20 uL 100 bp ladder and PCR product. Ran at 100 V for ~45 minutes.
Gel 1:
ladder A1 B1 C1 D1 E1 F1 G1 H1 A2 B2 C2 D2 E2 F2 G2


Gel 2:
ladder H2 A3 B3


Restreaked and seeded all colonies grown on 12.1.09 (see table below). Made 200 mL LB+Kan: 50 mL 5x lab stock + 160 mL nanopure H2O + 200 uL Kan. Aliquoted 5 mL of LB mix. to glass tubes with sponge stoppers. Touched a sterilized toothpick to each colony and dropped into growth medium. Based on gel results above, did the same for chosen colonies of PS#10 and PS#12a that appeared to have different products: 10-4, 10-5, 10-6, 12a-1, 12a-3, 12a-5. Grew up overnight at 37C, 250 rpm. Did not exceed 8 colonies for any primer pair.



December 1, 2009
Cloning of DD products: CO2 challenged juvenile oysters
Repeated procedure from 11.30.09 for primer sets 1, 9, 12 (400 bp), 18, 38 and 57. The following changes were made to the procedure:
Cloning reaction was cut in half so only 2 uL PCR product, 0.5 uL salt solution and 0.5 uL vector were used.
LB+Kan plates were streaked with volumes of either 50 uL or 200 uL competent, transformed cells.
Plates were streaked around 3 pm and left to incubate overnight at 37C.

November 30, 2009
Cloning of DD products: CO2 challenged juvenile oysters
Used TOPO TA cloning kit (Invitrogen), T10 competent cells.
PCR products to clone: primer st #10 (11.19.09), PS#12 (11.17.09) 200 bp band
Let bands thaw at RT. Spun at 5000 g for 10 min (RT) in ultrafree-DA tubes.
For cloning reaction in strip tubes:
4 uL PCR product
1 uL salt solution (TOPO kit)
0.9 uL vector (TOPO)
put on thermocycler for 10 minutes at 22C, then directly to ice.
Added 2 uL of each cloning reaction to a tube of competent cells (thawed on ice right before use); swirled as added. Incubated on ice for 10 minutes then heat shock in 42C water bath for 30 s. Put on ice for 2 minutes.
Added 250 uL room temp SOC medium to competent cells + cloning reaction. Rolled tubes to coat sides.
Put in 37C incubator at 225 rpm for 1 hour.
Warmed LB+Kan plates to RT (4 plates total). Spread with 80 uL 20mg/mL Xgal. Dried plates at 37C.
Plated out transformed cells, for each primer set plated 1 plate with 50 uL and one with 100 uL. Incubated at 37C with lids cracked to dry residual liquid and then upside down overnight.

Blue and white colonies appeared on all 4 plates. Colonies picked and restreaked on 12.2.09.

November 25, 2009
qPCR of CO2 challenged juvenile oysters
qPCR in duplicate of EF1, HIF , MDR, and Prx6 . Used cDNA from 11.6.09.

November 24, 2009
Differential Display: CO2 challenged juvenile oysters
Loaded PCR product for primer sets 56, 57, 58 (7 uL, 20 uL 100 bp ladder) on 2 % agarose gel, run at 100V for ~45 minutes. Imaged with UV.
Differential expression (high MW) in CO2 pool at primer set 57 (even though you can't see it, it is there! I'm just terrible at taking gel photos). Cut out band and stored at -20.

Uploaded with plasq's Skitch!

Cloning of DD products
Diluted 100 mL 5xLB (lab stock) with 400 mL nanopure water in large flask. Added 7.5 g Bacto Agar. Put in autoclave (121C, 20 minutes).
After autoclaving, let LB cool until flask is comfortable to touch for at least 30s. Added 500 uL Kanamycin (50 ug/mL). Swirled flask until homogenized. Poured LB+kan into sterile plates with lids until LB covered bottom. Let sit ~30 minutes til set. Stored in fridge.

November 23, 2009
Differential Display: CO2 challenged juvenile oysters

Uploaded with plasq's Skitch!

Gene fishing (SeeGene) PCR with 3 new primer sets: 56, 57, 58. There are no new primer sets left so will have to use Sigma kit if to continue gene discovery.


November 20, 2009
Differential Display: CO2 challenged juvenile oysters
New Gene fishing PCR with 7 new primers (same protocol as previously): 1, 16, 34, 35, 37, 39, 40.
Plate layout:

A	p1CO2	p1cont
B	p16CO2	p16cont
C	p34CO2	p34cont
D	p35CO2	p35cont
E	p37CO2	p37cont
F	p39CO2	p39cont
G	p40CO2	p40cont
H

- sr320 Nov 22, 2009please start embedding images as this is the only way we can backup notebooks- thanks

2% gel with 100 mL 1xTAE, 2 g agar, 10 uL EtBr.
Loaded 7 uL of each sample in order of primer pairs (1-40), control loaded first and CO2 loaded second.
Differential display of high MW band in primer set #1 control (gene is downregulated in CO2 group). Cut out band and stored in 1.5 mL eppie at -20C.


November 19, 2009
Differential Display: CO2 challenged juvenile oysters
Made 2% agarose gel: 100 mL 1xTAE, 2 g agar, 20 uL EtBr (oops!).
Loaded gel as follows (7 uL of each sample) and ran at 100 V for ~45 minutes. (20 uL 100 bp Ladder on far left)

p3cont

p3CO2

p4cont

p4CO2

p5cont

p5CO2

p8cont

p8CO2

p10cont

p10CO2

p11cont

p11CO2

p30cont

p30CO2

p33cont

p33CO2

Differentially expressed band in CO2 cDNA at primer set 10. Cut out and stored at -20.


November 18, 2009
Differential Display: CO2 challenged juvenile oysters
Same procedure as 11.13.09 and 11.12.09. 8 new primers:3,4,5,8,10,11,30,33.
PCR run on 96-well MJ thermocycler. Program called "DF".

Plate layout:

A	p3CO2	p3cont
B	p4CO2	p4cont
C	p5CO2	p5cont
D	p8CO2	p8cont
E	p10CO2	p10cont
F	p11CO2	p11cont
G	p30CO2	p30cont
H	p33CO2	p33cont

November 17, 2009
Differential Display: CO2 challenged juvenile oysters
Rony Thi re-ran previous DD samples (11.13 and 11.12) with 7 uL product per well. See her notebook for layout. Gel image here

Uploaded with plasq's Skitch!

November 13, 2009
Differential Display: CO2 challenged juvenile oysters
Made 2% agarose gel (100 mL 1x TAE + 2 g agar) with 10 uL EtBr.
Loaded 27.5 uL 100 bp ladder in leftmost well. Loaded samples, paired treatment and control, in primer pairs. Gel layout as follows:
ladder p12CO2 p12cont blank p17CO2 p17cont blank p18CO2 p18cont blank p20CO2 p20cont
Ran gel at 100 V for ~45 minutes.

Uploaded with plasq's Skitch!

Possible differential display of high MW band for primer 18.

PCR of 8 new primers:6,7,9,13,14,15,19,38 . Follow protocol from 11.12.09. Plate layout is:

A	CO2p6	contp6
B	CO2p7	contp7
C	CO2p9	contp9
D	CO2p13	contp13
E	CO2p14	contp14
F	CO2p15	contp15
G	CO2p19	contp19
H	CO2p38	contp38

November 12, 2009
DIfferential Display: CO2 challenged juvenile oysters
Resuspended pooled RNA in 18 uL water. Heated at 55 degrees C for 5 minutes.
'Speced pooled RNA on Nanodrop. Pool 1 was measured at 169.0, 170,3 and 172.3 ng/uL for an average of 170.53 ng/uL (3.08 ug) and Pool 2 was 26 ng/uL.
Repeat pooling and RNA precipitation for Pool 2. Resuspend in 9.5 uL DEPC H2O. Concentration on Nanodrop measured at 737.9 ng/uL and 745.4 ng/uL (average of 741.65 ng/uL, or .74165 ug/uL).
Following manufacturer's protocol for SeeGene GeneFishing, need up to 3 ug pooled RNA per reaction, no more than 7.5 uL. 7.5 uL of Pool 1 is 1.3 ug. 1.3 ug of Pool 2 is 1.75 uL.
RT reaction for Pool1:
7.5 uL RNA + 2 uL 10 uM dT-ACP1.
RT reaction for Pool2: 1.75 uL RNA + 2 uL 10 uM dT-ACP1 + 5.75 uL water
Incubated tubes at 80 degrees for 3 minutes then to ice for 2 minutes. Added to each tube: 4 uL RT 5x MMLV buffer, 4 uL 2.5 mM dNTPs, 1.5 uL water, 1 uL reverse transcriptase. Incubated on thermocycler 42 degrees for 90 minutes then 94 degrees for 2 minutes. Chilled for 2 minutes on ice and added 80 uL water to each tube. Vortexed to mix.

For PCR, added reagents to wells of plate (8 wells) according to following:
3 uL cDNA
2 uL 5mM arbitrary primer
1 uL 10 uM dT-ACP2
4 uL distilled water
10 uL SeeAmp 2x master mix
Plate layout as follows:

A	p12-CO2
B	p17-CO2
C	p18-CO2
D	p20-CO2
E	p12-cont
F	p17-cont
G	p18-cont
H	p20-cont

Placed on preheated (94C) thermocycler and started program: 94C 5 min; 50C 3 min; 72C 1 min; 40 cycles 94C 40s, 65C 40s, 72C 40s; 72C 5 min.

Stored finished PCR at -20 (and leftover cDNA).

November 11, 2009
Differential Display: CO2 challenged juvenile oysters
The following protocol basically follows Sigma's Differential Display manufacturer's protocol.
I. Nanodrop RNA samples (these samples are the 2x DNased)
Spec (2 sheets ) each sample (of 16) 3 times, average concentration for final concentration. Base subsequent calculations on this final concentration.
Pooling samples: Amount of RNA per pooled sample cannot exceed 8 ug or 18 uL. To determine amount of each sample that will go in to pool, set up equation in Excel so that as sample with smallest concentration's volume was increased, all other sample volumes would commensurately increase as well. Since total volumes ended up being larger than 18 uL, need to precipitate RNA and resuspend in appropriate volume.
Pool 1 (CO2 challenged)
Pool 2 (controls)

RNA Precipitation:
To each pool of RNA, add 0.1 volume 5 M ammonium acetate (9.36 for Pool 1 and 7.63 for Pool 2). Added 2 volumes 100% EtOH (205.9 uL and 167.88 uL, respectively) to each pooled RNA. Mixed well and incubated at -80 for 30 minutes.
Spin tube max speed (16,000xg) at 4 C for 30 minutes.
Discard supernatant and quick spin tubes to remove residual EtOH.
Add 1 mL 70% EtOH; flick to get pellet off bottom of tube.
Spin at max speed, 4C for 10 minutes. Discard supernatant.
Remove residual EtOH. Stored at -80.



November 9, 2009
RT qPCR of CO2 challenged oyster cDNA
Repeated qPCR of previously amplified HIF and MDR, in duplicate, to ensure consistency of results. Master mix and cycling parameters for PCR detailed here .

November 6, 2009
Reverse Transcription of CO2 challenged oyster RNA (take 2)
Adapted protocol for MMLV Reverse Transcription. Reactions are 25 uL, approximately 1 ug total RNA per reaction.
Added 1 uL from each sample, CO2 challenged (n=8) and control (n=8), to well in partial PCR plate. To each sample, added 16.75 uL ultra-clean water and 0.5 uL Oligo dT primers. Heated samples at 70 degrees C for 5 minutes (main directory on thermocycler, 75FOR5). Transferred samples immediately to ice for <10 minutes.
Prepared master mix (for 17 reactions):

Reagent
volx1	volx17
5x MMLV Buffer 5 uL	85 uL
10 mM dNTPs 1.25 uL	21.25 uL
M-MLV RT 0.5 uL	8.5 uL

Mixed well and added 6.75 uL to each RNA sample. Mixed, spun down and incubated at 42 degrees for 1 hour followed by 3 minutes deactivation at 95 degrees C (REVTINC).

RT-qPCR
Diluted cDNA 1:10 by putting entire cDNA reaction sample in 225 uL of pure H2O (eppie tubes, stored at -20). Prepared master mix and did qPCR at EF1 and Prx6 in duplicate according to here .


November 3, 2009
RT-qPCR on Vibrio & CO2 challenged oyster cDNA
PCR on genes MTIV, hsp70, Prx6, and HIF1a.

November 2, 2009
RT-qPCR on Vibrio & CO2 challenged oyster cDNA
Same as 10/29/2009 but with new primers MDR, SOD, and AURKA. No positive control. See here for layout, etc.

October 29, 2009
RT-qPCR on Vibrio & CO2 challenged oyster cDNA
Did RT-qPCR on all 16 gigas samples for genes elongation factor 1, Interleukin 17 Isoform D, and Cytochrome P450.
Working stock primers were all prepared fresh: 90 uL H2O + 10 uL 100 uM stock to make 10 uM solution. Positive control C. gigas cDNA was provided by SW. Experimental cDNA samples were brought up to 80 uL (1:4 dilution) with 60 uL H2O. Master mix and PCR performed according to here .

October 28, 2009
Vibrio & CO2 challenged oysters: test for contamination
gDNA contamination apparent in all samples and blank controls. Made new 10 uM stock 18s gigas primers and got new aliquot of PCR water. Ran PCR of blanks and positive controls to ensure no contamination according (here ) .
Results: blanks were clean, gDNA controls amplified as expected.

qPCR of 2xDNased 1:20 dilutions from 10/27/09 as seen here .

gDNA contamination gone from samples (proper amplification of positive controls, empty negative controls). Performed reverse transcription on RNA samples (undiluted 2xDNased).
Transferred 5 uL of each sample into strip tube. Incubated at 75 degrees C for 5 minutes. Transferred to ice for 5+ minutes.
Prepared master mix (x18):
72 uL 5x AMV RT buffer
144 uL 10 mM dNTP mix
18 uL AMV RTranscriptase
18 uL Oligo dT Primer
18 uL RNase free water
Aliquot 15 uL of master mix into each sample well. Incubated for 10 minutes at RT. Incubated at 37 degrees for 1 hour then at 95 degrees for 3 minutes. Store at -20.

October 27, 2009
Vibrio & CO2 challenged oysters: gDNA clean-up (x2)
Still detectable gDNA contamination in PCR. Repeated clean-up protocol from Oct. 23, but performed protocol on samples that were cleaned once already. Since 5 uL had been removed from each of these to make the 1:20 dilution for the PCR, added only 4.5 uL TURBO buffer to the RNA. Prepped 1:20 dilutions for RT PCR to check genomic contamination. Discarded previous dilutions so all DNased samples and dilutions have undergone 2 rounds of DNasing.

Repeated PCR identical to 10/26 with 2xDNased RNA (same layout, master mix, and cycling parameters). See sheet from 10/26/09.

October 26, 2009
Vibrio & CO2 challenged oysters: gDNA clean-up
Still evidence of contamination in Dnased samples from 10.23, but SW and MG say that is probably only detectable because did not dilute RNA template enough before PCR. Repeated protocol from 10.23 but used 5 uL of 1:20 dilutions of DNased RNA template. Master mix, plate layout, and cycling parameters here .

October 23, 2009
Vibrio & CO2 challenged oysters: gDNA clean-up
For each RNA sample, added either 10 or 5 uL RNA to 40 or 45 uL water. This was determined based on concentrations from the Nanodrop (see 10.7 and 10.15). Samples with concentrations >1 ug/mL were diluted 5 uL RNA in 45 uL water; samples with concentrations <1ug/mL were diluted 10 uL RNA in 40 uL water. The 10 uL samples were CO2 juv 1, CO2 juv 5, CO2 juv6, and cont juv 7. The rest were diluted 5 uL in 45 uL water. (All in 0.5 mL tubes.)
To the 50 uL diluted RNA, added 5 uL 10x TURBO Buffer (Ambion TURBO DNA free kit) and 1 uL TURBO DNase (2U). Mixed gently and spun down.
Incubated samples at 37 degrees C water bath for 30 minutes.
Added 5 uL DNase Inactivation Reagent to each tube (before adding, vortexed DIR to resuspend). Vortexed samples with DIR. Incubated at room temp for 2 minutes, vortexing twice during incubation. Centrifuged samples at 10000 xg for 1.5 minutes. Transferred RNA (supernatant) to clean tubes labeled with name of sample, "RNA", and "gDNA-free", date, and initials. After PCR, stored cleaned RNA at -80.
Prepared qPCR master mix with 18s gigas primers and performed qPCR following previous protocol as outlined here . (Only change is used 1 uL template instead of 5 uL, and 24 uL master mix per reaction.)


October 15, 2009
Vibrio & CO2 challenged oysters: Nanodrop & RT-PCR
Measured concentration of RNA extractions from 10.14.09 on Nanodrop . NB: second "control-1" is really control-2.

Prepared master mix and ran RT-PCR as outlined here .

October 14, 2009
Vibrio & CO2 challenged oysters: RNA Extraction
Extracted from remaining whole body samples from TG's experiment. (See Oct. 7)
Tissue weights and 1/2 TriReagent volume:
CO2 juv 1 0.29 g 1.5 mL Tri
CO2 juv 2 0.28 g 1.5 mL Tri
CO2 juv 3 0.56 g 3 mL Tri
CO2 juv 4 0.22 g 1.25 mL Tri
CO2 juv 7 0.53 g 2.75 mL Tri
CO2 juv 8 0.20 g 1 mL Tri
cont juv 1 0.37 g 2 mL Tri
cont juv 2 0.33 g 1.75 mL Tri
cont juv 3 0.38 g 2 mL Tri
cont juv 4 0.48 g 2.5 mL Tri
cont juv 5 0.37 g 2 mL Tri
cont juv 6 0.88 g 4.5 mL Tri

Tissues were homogenized using sonicator in volume of TriReagent indicated above. 500 uL of homogenate and 500 uL of fresh Tri were then combined in eppie tub and mixed thoroughly. Remaining tissue homogenized in 1/2 Tri was stored at -80 in 15 mL Falcon tubes. RNA was extracted following manufacturer's protocol.
Pellets are a grayish-brown color but solubilized easily in water.

October 12, 2009
RT-PCR of oyster RNA to determine genomic contamination
RNA from 10.7.09
PCR consists of 4 experimental samples (CO2 juv 5, CO2 juv 6, control juv 7 , and control juv 8), 4 negative controls of 5 uL water instead of template, 1 negative control of just master mix, and 3 positive controls of genomic oyster DNA at different dilutions (1:10, 1:100, 1:1000).
Prepared master mix and ran RT PCR as outlined in data sheet .

October 7, 2009
Vibrio & CO2 challenged oysters: RNA Extraction
Selected 4 juvenile whole body samples from Tim's experiment. 2 were challenged with 970 ppm CO2 and 2 were controls.
Tissue weights:
CO2 juv 5 0.17g 1 mL Tri
CO2 juv 6 0.38 g 2 mL Tri
control juv 7 0.16g 1 mL Tri
control juv 8 0.86g 4.5 mL Tri
Added 1/2 suggested Tri Reagent to each sample (volumes next to weights) and homogenized with tissue sonicator. Added 0.5 mL of homogenized tissue in 1/2 Tri to 0.5 mL Tri for 1 mL volume samples. Stored remaining tissue in 1/2 Tri in 15 mL Falcon tubes in -80.
Followed manufacturer's protocol for remaining RNA extraction.
During first spin (10000 rpm for 15 min at 4 degrees C) CO2 juv 5 and control juv 7 tubes shattered in rotor tubes. Removed samples from rotor, put in new falcon tubes and respun (will now be one step behind CO2 juv 6 and control juv 8). Continued in protocol for samples 6 & 8 (isopropanol step).
5 & 7 pellets are black, so probably no good but will continue extraction anyway.
Afters spec'-ing samples on Nanodrop, stored in -80. Labeled eppie tubes with sample name (as above), date, and RNA.

RNA concentration on Nanodrop 10.7.09
Sample ID	ng/uL	A260	A280	260/280
CO25	294.4	7.36	3.7	1.99
CO26	565.61	14.14	7.212	2.34
Cont7	650.46	16.262	7.893	2.06
Cont8	2194.82	54.87	27.557	1.95

September 21, 2009
Salmon Senescence: RNA Extraction
Selected 4 brain samples for extraction: 21, 23, 24, and 27
Brain weights:
#21 0.47g
#23 0.48 g
#24 0.39 g
#27 0.51 g

(For the most part I followed the manufacturer's protocol.)
Cleaned homogenizers before use. Transferred all tissue to 5 mL Tri Reagent (this is half the amount of total reagent that should be used for this amount of tissue). Homogenized tissue twice.
Transferred 3.5 mL of the homogenate to 3.5 mL of fresh Tri Reagent in clean tubes (remaining homogenate was stored in 50 mL Falcon tubes at -80). Thoroughly vortexed tubes and let sit for 5 minutes at room temperature.
Added 1.4 mL chloroform to 7 mL of Tri Reagent mixture. Let sit for 15 minutes at room temp.
Put 3.5 mL isopropanol in a clean tube and added aqueous (top) phase of Tri-mixture. Sample 27 had the least amount of aqueous phase and a very large interphase. Let sit for 10 min at room temp and centrifuged 12000xg for 8 min (SR did this part).
Decanted/removed all isopropanol and washed remaining pellet with 7 mL 75% EtOH. Centrifuged 5 min at 10000 rpm.
Removed EtOH with pipet and quickly centrifuged. Removed remaining EtOH with pipet and kimwipe. Let tubes air dry in hood for 5 minutes. All were dry except for 27.
Resuspended 21, 23, & 24 in 50 uL nuclease-free water (27 was left to dry longer). Measured RNA concentrations on the nanodrop (the "view report" function wasn't working so the following are approximate results):
#21 ~1600 ng/uL
#23 ~1400 ng/uL
#24 ~1400 ng/uL
27 was not completely dry, but consulted Sam and resuspended in 50 uL water followed by heating in water bath at ~55 degrees for 5 minutes. Its concentration was 176 ng/uL.
Stored extracted RNA in -80 in box labeled "Salmon Senescence".